ID: 1121666208 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:95674373-95674395 |
| Sequence | GCTTGTTTCTAAGGATGGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1121666202_1121666208 | 4 | Left | 1121666202 | 14:95674346-95674368 | CCATCATGAAAAAATGGTGGTGA | No data | ||
| Right | 1121666208 | 14:95674373-95674395 | GCTTGTTTCTAAGGATGGGAGGG | No data | ||||
| 1121666199_1121666208 | 20 | Left | 1121666199 | 14:95674330-95674352 | CCACATACTATATTGACCATCAT | No data | ||
| Right | 1121666208 | 14:95674373-95674395 | GCTTGTTTCTAAGGATGGGAGGG | No data | ||||
| 1121666198_1121666208 | 21 | Left | 1121666198 | 14:95674329-95674351 | CCCACATACTATATTGACCATCA | No data | ||
| Right | 1121666208 | 14:95674373-95674395 | GCTTGTTTCTAAGGATGGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1121666208 | Original CRISPR | GCTTGTTTCTAAGGATGGGA GGG | Intergenic | ||