ID: 1121673297

View in Genome Browser
Species Human (GRCh38)
Location 14:95730349-95730371
Sequence CCGAGTCATCACATCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121673297_1121673299 10 Left 1121673297 14:95730349-95730371 CCTGGATGGATGTGATGACTCGG No data
Right 1121673299 14:95730382-95730404 ATGTCAGTTTTCCCCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121673297 Original CRISPR CCGAGTCATCACATCCATCC AGG (reversed) Intergenic
No off target data available for this crispr