ID: 1121679145

View in Genome Browser
Species Human (GRCh38)
Location 14:95778235-95778257
Sequence GTTTGCCAATTTAAGATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121679145_1121679152 21 Left 1121679145 14:95778235-95778257 CCCAAGATCTTAAATTGGCAAAC No data
Right 1121679152 14:95778279-95778301 GGTGTAGTTCCAGTCTGAATCGG No data
1121679145_1121679153 25 Left 1121679145 14:95778235-95778257 CCCAAGATCTTAAATTGGCAAAC No data
Right 1121679153 14:95778283-95778305 TAGTTCCAGTCTGAATCGGAAGG No data
1121679145_1121679149 0 Left 1121679145 14:95778235-95778257 CCCAAGATCTTAAATTGGCAAAC No data
Right 1121679149 14:95778258-95778280 TGGAGACCCAGGAGAGCTGATGG 0: 46
1: 101
2: 322
3: 553
4: 1202
1121679145_1121679155 30 Left 1121679145 14:95778235-95778257 CCCAAGATCTTAAATTGGCAAAC No data
Right 1121679155 14:95778288-95778310 CCAGTCTGAATCGGAAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121679145 Original CRISPR GTTTGCCAATTTAAGATCTT GGG (reversed) Intergenic
No off target data available for this crispr