ID: 1121679182

View in Genome Browser
Species Human (GRCh38)
Location 14:95778493-95778515
Sequence TTGGATGAGGCCCACCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121679176_1121679182 7 Left 1121679176 14:95778463-95778485 CCCTTTGGTTCTATTCAGGCCTT 0: 3
1: 78
2: 239
3: 470
4: 736
Right 1121679182 14:95778493-95778515 TTGGATGAGGCCCACCATATTGG No data
1121679177_1121679182 6 Left 1121679177 14:95778464-95778486 CCTTTGGTTCTATTCAGGCCTTT No data
Right 1121679182 14:95778493-95778515 TTGGATGAGGCCCACCATATTGG No data
1121679173_1121679182 30 Left 1121679173 14:95778440-95778462 CCTCTTACTCTCAGGCACGTCAG No data
Right 1121679182 14:95778493-95778515 TTGGATGAGGCCCACCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121679182 Original CRISPR TTGGATGAGGCCCACCATAT TGG Intergenic
No off target data available for this crispr