ID: 1121682517

View in Genome Browser
Species Human (GRCh38)
Location 14:95805496-95805518
Sequence TCTGATTTGCAGTGATTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121682513_1121682517 10 Left 1121682513 14:95805463-95805485 CCACTGGAAAGCTTTAAGCGAGG No data
Right 1121682517 14:95805496-95805518 TCTGATTTGCAGTGATTGCCAGG No data
1121682511_1121682517 27 Left 1121682511 14:95805446-95805468 CCTTTGGATGATGTGAGCCACTG No data
Right 1121682517 14:95805496-95805518 TCTGATTTGCAGTGATTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121682517 Original CRISPR TCTGATTTGCAGTGATTGCC AGG Intergenic
No off target data available for this crispr