ID: 1121684877

View in Genome Browser
Species Human (GRCh38)
Location 14:95828386-95828408
Sequence ATAAATTATAAGGCCAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121684877_1121684880 13 Left 1121684877 14:95828386-95828408 CCATATTTGGCCTTATAATTTAT No data
Right 1121684880 14:95828422-95828444 AAATCCACTATCTATTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121684877 Original CRISPR ATAAATTATAAGGCCAAATA TGG (reversed) Intergenic
No off target data available for this crispr