ID: 1121687895

View in Genome Browser
Species Human (GRCh38)
Location 14:95852767-95852789
Sequence CTGTGTTTTGGGCAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121687889_1121687895 -10 Left 1121687889 14:95852754-95852776 CCAGCCAACACATCTGTGTTTTG No data
Right 1121687895 14:95852767-95852789 CTGTGTTTTGGGCAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121687895 Original CRISPR CTGTGTTTTGGGCAGGAGGA TGG Intergenic
No off target data available for this crispr