ID: 1121687983

View in Genome Browser
Species Human (GRCh38)
Location 14:95853663-95853685
Sequence AAGGATCCACAAGATGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121687983_1121687985 0 Left 1121687983 14:95853663-95853685 CCATGGGCATCTTGTGGATCCTT No data
Right 1121687985 14:95853686-95853708 ATTAATACTGCCTAAATAAATGG No data
1121687983_1121687987 13 Left 1121687983 14:95853663-95853685 CCATGGGCATCTTGTGGATCCTT No data
Right 1121687987 14:95853699-95853721 AAATAAATGGAGTCTTCTTGTGG No data
1121687983_1121687988 20 Left 1121687983 14:95853663-95853685 CCATGGGCATCTTGTGGATCCTT No data
Right 1121687988 14:95853706-95853728 TGGAGTCTTCTTGTGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121687983 Original CRISPR AAGGATCCACAAGATGCCCA TGG (reversed) Intergenic
No off target data available for this crispr