ID: 1121690550

View in Genome Browser
Species Human (GRCh38)
Location 14:95875192-95875214
Sequence GGGGCACAGCGGTGGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121690544_1121690550 -7 Left 1121690544 14:95875176-95875198 CCATCCAACTGGGGAAGGGGCAC No data
Right 1121690550 14:95875192-95875214 GGGGCACAGCGGTGGGCCCTGGG No data
1121690540_1121690550 0 Left 1121690540 14:95875169-95875191 CCTTGCACCATCCAACTGGGGAA No data
Right 1121690550 14:95875192-95875214 GGGGCACAGCGGTGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121690550 Original CRISPR GGGGCACAGCGGTGGGCCCT GGG Intergenic
No off target data available for this crispr