ID: 1121692765

View in Genome Browser
Species Human (GRCh38)
Location 14:95889651-95889673
Sequence TAAGTTCCTCCTCACGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121692765_1121692773 28 Left 1121692765 14:95889651-95889673 CCTCCCTCGTGAGGAGGAACTTA No data
Right 1121692773 14:95889702-95889724 ACGGAGCCGTCACCCCTGTCTGG No data
1121692765_1121692768 9 Left 1121692765 14:95889651-95889673 CCTCCCTCGTGAGGAGGAACTTA No data
Right 1121692768 14:95889683-95889705 TCATCTTCCCTGTAAGCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121692765 Original CRISPR TAAGTTCCTCCTCACGAGGG AGG (reversed) Intergenic
No off target data available for this crispr