ID: 1121693555

View in Genome Browser
Species Human (GRCh38)
Location 14:95894706-95894728
Sequence GGAAGAGCAAGCTCTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121693551_1121693555 -7 Left 1121693551 14:95894690-95894712 CCCTAAGGCCATGCCTGGAAGAG No data
Right 1121693555 14:95894706-95894728 GGAAGAGCAAGCTCTCCCACAGG No data
1121693552_1121693555 -8 Left 1121693552 14:95894691-95894713 CCTAAGGCCATGCCTGGAAGAGC No data
Right 1121693555 14:95894706-95894728 GGAAGAGCAAGCTCTCCCACAGG No data
1121693550_1121693555 -6 Left 1121693550 14:95894689-95894711 CCCCTAAGGCCATGCCTGGAAGA No data
Right 1121693555 14:95894706-95894728 GGAAGAGCAAGCTCTCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121693555 Original CRISPR GGAAGAGCAAGCTCTCCCAC AGG Intergenic
No off target data available for this crispr