ID: 1121694611

View in Genome Browser
Species Human (GRCh38)
Location 14:95902658-95902680
Sequence GGTAATCATGGGGATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121694601_1121694611 13 Left 1121694601 14:95902622-95902644 CCAGGGGCATTTGGAAATGGGGA No data
Right 1121694611 14:95902658-95902680 GGTAATCATGGGGATGGGGTGGG No data
1121694597_1121694611 15 Left 1121694597 14:95902620-95902642 CCCCAGGGGCATTTGGAAATGGG No data
Right 1121694611 14:95902658-95902680 GGTAATCATGGGGATGGGGTGGG No data
1121694599_1121694611 14 Left 1121694599 14:95902621-95902643 CCCAGGGGCATTTGGAAATGGGG No data
Right 1121694611 14:95902658-95902680 GGTAATCATGGGGATGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121694611 Original CRISPR GGTAATCATGGGGATGGGGT GGG Intergenic
No off target data available for this crispr