ID: 1121695353

View in Genome Browser
Species Human (GRCh38)
Location 14:95908024-95908046
Sequence CCAGTCCTGCAGATCAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121695353_1121695361 10 Left 1121695353 14:95908024-95908046 CCCAGTTTGATCTGCAGGACTGG No data
Right 1121695361 14:95908057-95908079 CCCAGCCTTCAGGCCCTCCCTGG 0: 62
1: 141
2: 190
3: 267
4: 681
1121695353_1121695365 21 Left 1121695353 14:95908024-95908046 CCCAGTTTGATCTGCAGGACTGG No data
Right 1121695365 14:95908068-95908090 GGCCCTCCCTGGCCTTAAGGTGG No data
1121695353_1121695364 18 Left 1121695353 14:95908024-95908046 CCCAGTTTGATCTGCAGGACTGG No data
Right 1121695364 14:95908065-95908087 TCAGGCCCTCCCTGGCCTTAAGG No data
1121695353_1121695357 0 Left 1121695353 14:95908024-95908046 CCCAGTTTGATCTGCAGGACTGG No data
Right 1121695357 14:95908047-95908069 CAGTCTGGCCCCCAGCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121695353 Original CRISPR CCAGTCCTGCAGATCAAACT GGG (reversed) Intergenic
No off target data available for this crispr