ID: 1121695487

View in Genome Browser
Species Human (GRCh38)
Location 14:95908862-95908884
Sequence CCCCTACTCCCTGTTAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121695477_1121695487 8 Left 1121695477 14:95908831-95908853 CCATACCTGGAACCCAAATCCCT No data
Right 1121695487 14:95908862-95908884 CCCCTACTCCCTGTTAGTCCTGG No data
1121695481_1121695487 -4 Left 1121695481 14:95908843-95908865 CCCAAATCCCTGGGTCCTTCCCC No data
Right 1121695487 14:95908862-95908884 CCCCTACTCCCTGTTAGTCCTGG No data
1121695480_1121695487 3 Left 1121695480 14:95908836-95908858 CCTGGAACCCAAATCCCTGGGTC No data
Right 1121695487 14:95908862-95908884 CCCCTACTCCCTGTTAGTCCTGG No data
1121695482_1121695487 -5 Left 1121695482 14:95908844-95908866 CCAAATCCCTGGGTCCTTCCCCT No data
Right 1121695487 14:95908862-95908884 CCCCTACTCCCTGTTAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121695487 Original CRISPR CCCCTACTCCCTGTTAGTCC TGG Intergenic
No off target data available for this crispr