ID: 1121696802

View in Genome Browser
Species Human (GRCh38)
Location 14:95920233-95920255
Sequence CCTCCTGAAAACCATTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121696802_1121696814 19 Left 1121696802 14:95920233-95920255 CCACAATAATGGTTTTCAGGAGG No data
Right 1121696814 14:95920275-95920297 GGGCACTGTGGGAGGCCCCTGGG No data
1121696802_1121696807 -3 Left 1121696802 14:95920233-95920255 CCACAATAATGGTTTTCAGGAGG No data
Right 1121696807 14:95920253-95920275 AGGTAGGGATAGTGATTGGATGG No data
1121696802_1121696806 -7 Left 1121696802 14:95920233-95920255 CCACAATAATGGTTTTCAGGAGG No data
Right 1121696806 14:95920249-95920271 CAGGAGGTAGGGATAGTGATTGG No data
1121696802_1121696809 -1 Left 1121696802 14:95920233-95920255 CCACAATAATGGTTTTCAGGAGG No data
Right 1121696809 14:95920255-95920277 GTAGGGATAGTGATTGGATGGGG No data
1121696802_1121696816 29 Left 1121696802 14:95920233-95920255 CCACAATAATGGTTTTCAGGAGG No data
Right 1121696816 14:95920285-95920307 GGAGGCCCCTGGGTGCTGGAAGG No data
1121696802_1121696811 8 Left 1121696802 14:95920233-95920255 CCACAATAATGGTTTTCAGGAGG No data
Right 1121696811 14:95920264-95920286 GTGATTGGATGGGGCACTGTGGG No data
1121696802_1121696808 -2 Left 1121696802 14:95920233-95920255 CCACAATAATGGTTTTCAGGAGG No data
Right 1121696808 14:95920254-95920276 GGTAGGGATAGTGATTGGATGGG No data
1121696802_1121696815 25 Left 1121696802 14:95920233-95920255 CCACAATAATGGTTTTCAGGAGG No data
Right 1121696815 14:95920281-95920303 TGTGGGAGGCCCCTGGGTGCTGG No data
1121696802_1121696812 11 Left 1121696802 14:95920233-95920255 CCACAATAATGGTTTTCAGGAGG No data
Right 1121696812 14:95920267-95920289 ATTGGATGGGGCACTGTGGGAGG No data
1121696802_1121696810 7 Left 1121696802 14:95920233-95920255 CCACAATAATGGTTTTCAGGAGG No data
Right 1121696810 14:95920263-95920285 AGTGATTGGATGGGGCACTGTGG No data
1121696802_1121696813 18 Left 1121696802 14:95920233-95920255 CCACAATAATGGTTTTCAGGAGG No data
Right 1121696813 14:95920274-95920296 GGGGCACTGTGGGAGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121696802 Original CRISPR CCTCCTGAAAACCATTATTG TGG (reversed) Intergenic
No off target data available for this crispr