ID: 1121697582

View in Genome Browser
Species Human (GRCh38)
Location 14:95926361-95926383
Sequence GTTGTATTGTGATCAATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121697582_1121697586 15 Left 1121697582 14:95926361-95926383 CCCTGTATTGATCACAATACAAC No data
Right 1121697586 14:95926399-95926421 TGGCCTTTCACCTCTCCTCTGGG No data
1121697582_1121697584 -5 Left 1121697582 14:95926361-95926383 CCCTGTATTGATCACAATACAAC No data
Right 1121697584 14:95926379-95926401 ACAACTGATCACAATACAACTGG No data
1121697582_1121697585 14 Left 1121697582 14:95926361-95926383 CCCTGTATTGATCACAATACAAC No data
Right 1121697585 14:95926398-95926420 CTGGCCTTTCACCTCTCCTCTGG No data
1121697582_1121697588 19 Left 1121697582 14:95926361-95926383 CCCTGTATTGATCACAATACAAC No data
Right 1121697588 14:95926403-95926425 CTTTCACCTCTCCTCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121697582 Original CRISPR GTTGTATTGTGATCAATACA GGG (reversed) Intergenic
No off target data available for this crispr