ID: 1121702269

View in Genome Browser
Species Human (GRCh38)
Location 14:95963546-95963568
Sequence CAGTTTATACAGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121702265_1121702269 8 Left 1121702265 14:95963515-95963537 CCAAGGTACAGAAAGGCTAAATA No data
Right 1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG No data
1121702264_1121702269 9 Left 1121702264 14:95963514-95963536 CCCAAGGTACAGAAAGGCTAAAT No data
Right 1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG No data
1121702258_1121702269 30 Left 1121702258 14:95963493-95963515 CCCCATTTTGCGGATGAGTACCC No data
Right 1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG No data
1121702263_1121702269 10 Left 1121702263 14:95963513-95963535 CCCCAAGGTACAGAAAGGCTAAA No data
Right 1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG No data
1121702259_1121702269 29 Left 1121702259 14:95963494-95963516 CCCATTTTGCGGATGAGTACCCC No data
Right 1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG No data
1121702260_1121702269 28 Left 1121702260 14:95963495-95963517 CCATTTTGCGGATGAGTACCCCA No data
Right 1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121702269 Original CRISPR CAGTTTATACAGAGGGCAGA TGG Intergenic
No off target data available for this crispr