ID: 1121704857

View in Genome Browser
Species Human (GRCh38)
Location 14:95983866-95983888
Sequence CTGGCTACTGGCCGTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121704857_1121704862 4 Left 1121704857 14:95983866-95983888 CCAAAAGAACGGCCAGTAGCCAG No data
Right 1121704862 14:95983893-95983915 TGGCCAGTGCCTAGATACAAAGG No data
1121704857_1121704865 23 Left 1121704857 14:95983866-95983888 CCAAAAGAACGGCCAGTAGCCAG No data
Right 1121704865 14:95983912-95983934 AAGGCCCAGCTCTCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121704857 Original CRISPR CTGGCTACTGGCCGTTCTTT TGG (reversed) Intergenic
No off target data available for this crispr