ID: 1121709451

View in Genome Browser
Species Human (GRCh38)
Location 14:96026780-96026802
Sequence CAGCAGAAGGAGAAGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121709447_1121709451 -2 Left 1121709447 14:96026759-96026781 CCATGAAGGAGGAGGAGGATGCA No data
Right 1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121709451 Original CRISPR CAGCAGAAGGAGAAGGAGAT GGG Intergenic
No off target data available for this crispr