ID: 1121709763

View in Genome Browser
Species Human (GRCh38)
Location 14:96028900-96028922
Sequence TTGTCCATGCACACCCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121709763_1121709772 12 Left 1121709763 14:96028900-96028922 CCCTGATGGGTGTGCATGGACAA No data
Right 1121709772 14:96028935-96028957 GGGGCCATTGAGGTGGGCAGAGG No data
1121709763_1121709769 2 Left 1121709763 14:96028900-96028922 CCCTGATGGGTGTGCATGGACAA No data
Right 1121709769 14:96028925-96028947 GAAAGCAAGTGGGGCCATTGAGG No data
1121709763_1121709768 -7 Left 1121709763 14:96028900-96028922 CCCTGATGGGTGTGCATGGACAA No data
Right 1121709768 14:96028916-96028938 TGGACAAAGGAAAGCAAGTGGGG No data
1121709763_1121709766 -9 Left 1121709763 14:96028900-96028922 CCCTGATGGGTGTGCATGGACAA No data
Right 1121709766 14:96028914-96028936 CATGGACAAAGGAAAGCAAGTGG No data
1121709763_1121709773 13 Left 1121709763 14:96028900-96028922 CCCTGATGGGTGTGCATGGACAA No data
Right 1121709773 14:96028936-96028958 GGGCCATTGAGGTGGGCAGAGGG No data
1121709763_1121709770 5 Left 1121709763 14:96028900-96028922 CCCTGATGGGTGTGCATGGACAA No data
Right 1121709770 14:96028928-96028950 AGCAAGTGGGGCCATTGAGGTGG No data
1121709763_1121709771 6 Left 1121709763 14:96028900-96028922 CCCTGATGGGTGTGCATGGACAA No data
Right 1121709771 14:96028929-96028951 GCAAGTGGGGCCATTGAGGTGGG No data
1121709763_1121709767 -8 Left 1121709763 14:96028900-96028922 CCCTGATGGGTGTGCATGGACAA No data
Right 1121709767 14:96028915-96028937 ATGGACAAAGGAAAGCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121709763 Original CRISPR TTGTCCATGCACACCCATCA GGG (reversed) Intergenic
No off target data available for this crispr