ID: 1121711987

View in Genome Browser
Species Human (GRCh38)
Location 14:96045358-96045380
Sequence CTGTGTGCACAAAGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121711987 Original CRISPR CTGTGTGCACAAAGGCAAGA AGG Intronic
900037606 1:430501-430523 CTGTGAGCTCTAAGTCAAGAAGG + Intergenic
901032874 1:6318483-6318505 CTTTGTGCACGGAGGTAAGAAGG - Exonic
903934550 1:26886204-26886226 ATGAGTGCACAAAGGAAAAAAGG - Intronic
905592070 1:39172891-39172913 CTGTCTGCCAGAAGGCAAGAAGG - Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
908661189 1:66437005-66437027 CTGAATGCACACAGCCAAGAAGG + Intergenic
908715484 1:67065344-67065366 CTGTGTGCAGAAAGGATTGATGG - Intergenic
910781889 1:90947017-90947039 CTGTGTGGATGAAGGCAAGGAGG + Intronic
911463638 1:98223060-98223082 CTGTGTTCACAAAGTTAAAAGGG - Intergenic
912432984 1:109639285-109639307 CTGGGTGGACAGATGCAAGATGG + Intergenic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG + Intergenic
917163928 1:172090382-172090404 CTGTGTGCGCCAGGGCATGAGGG + Intronic
917253268 1:173086451-173086473 CTGTGTCCTCACAAGCAAGAAGG + Intergenic
918474192 1:184905550-184905572 ATGTATGCACAGGGGCAAGAAGG - Intronic
919656827 1:200205148-200205170 CAGTGTGCACAAAGTCATGGAGG + Intergenic
921512140 1:216045038-216045060 CTGTGAGCACCAAGAGAAGAGGG + Intronic
922217257 1:223530251-223530273 CCTTGTGGACAAAGGAAAGACGG + Intergenic
922367594 1:224880633-224880655 CTGTTTGCACACTGGGAAGATGG + Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
1065965458 10:30766918-30766940 CTGTGGCCACAAAGGAAAGATGG - Intergenic
1068037658 10:51781379-51781401 CTGTTTCCCCAAAGGCAAGAGGG + Intronic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1068639589 10:59388269-59388291 CTCTCTCCACAAAGGCAACAAGG - Intergenic
1069192643 10:65508854-65508876 CTGTGCTTACTAAGGCAAGAAGG - Intergenic
1071469648 10:85974670-85974692 CTGGTTGCAGAAAGTCAAGAGGG - Intronic
1073293561 10:102425137-102425159 GTGTCTGGACAAAGGCAAGGAGG + Exonic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1074443702 10:113500595-113500617 TTGTGTGCAGAACAGCAAGAAGG - Intergenic
1075098447 10:119489343-119489365 CTGTGTGCACAGAGGCTTAAAGG - Intergenic
1075104818 10:119532020-119532042 AGGTGAGCAAAAAGGCAAGAAGG - Intronic
1075815430 10:125261265-125261287 GTGTGTGAACAAAGCCAGGAAGG + Intergenic
1075936695 10:126348494-126348516 ATGTGGGAACAAATGCAAGAGGG + Intronic
1076311896 10:129514542-129514564 CTGTATGCAAAAAAGCAAGAAGG - Intronic
1076964333 11:68424-68446 CTGTGAGCTCTAAGTCAAGAAGG + Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078106130 11:8359084-8359106 CTGTCATCACAAAGGCAATAAGG + Intergenic
1078867440 11:15311193-15311215 CTGTGTGTACAGAGACATGAAGG - Intergenic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1081818538 11:45968218-45968240 TTCTCTGCACAGAGGCAAGAAGG + Intronic
1082173261 11:49031757-49031779 CTGAATGCACAAAGTCAACAGGG + Exonic
1085652765 11:78283312-78283334 CTTTGTGCACAAATGGAAAAAGG - Intronic
1088692051 11:112336610-112336632 CAGTGTGCACAGAGGCAAAGGGG + Intergenic
1089283541 11:117391276-117391298 CTGAGTGCACAAGGAGAAGAAGG + Intronic
1089637663 11:119826510-119826532 CTGGGTGCCCAGAGGCAACATGG + Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090346641 11:126076912-126076934 CTGTGCTCACAAATGCCAGAGGG + Intergenic
1090451237 11:126808186-126808208 CTGGGAGCATAAAGGAAAGAGGG + Intronic
1091001575 11:131914110-131914132 CTGTGTACAGAGAGGCAAGTAGG + Intronic
1092918165 12:13206860-13206882 CTGCCTGAACAAAGGCAACAAGG + Intronic
1095353006 12:41237032-41237054 CAGATTGCAAAAAGGCAAGAAGG + Intronic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1099981210 12:89605443-89605465 AAGTGAGCACAAAAGCAAGAGGG - Intronic
1100162840 12:91880704-91880726 CTGTGTGCAGATAGACAATAGGG - Intergenic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1103904195 12:124319129-124319151 CTGTGTGGGCAAAGGCTAGGAGG - Intergenic
1104495890 12:129238173-129238195 ATGGGTGCACACAGGCAAGACGG + Intronic
1104628359 12:130378148-130378170 CTGCTTGCAAAGAGGCAAGATGG - Intergenic
1104720823 12:131044284-131044306 CTGTGTGCACAAAAGCATCGGGG + Intronic
1105614470 13:21999785-21999807 CTGGGTGCAGGAAGGCAAGAGGG + Intergenic
1106685011 13:32049337-32049359 TTGTGTATACAAAGGCAAGTTGG + Intronic
1106754294 13:32806891-32806913 CTGAGTGCCCAACGGCAAGAAGG - Intergenic
1106999610 13:35527525-35527547 CTGGGTGCCCAAAGTCCAGACGG + Intronic
1108969764 13:56358863-56358885 CTGTGTACACCAAAGCAATAAGG + Intergenic
1109528400 13:63606383-63606405 CTCTGTGCCCATAGACAAGAGGG - Intergenic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1111997380 13:95178092-95178114 CTGTATGGACAAAGGAAAGAAGG + Intronic
1113352981 13:109547699-109547721 GTGAGTGAACAAAGGCCAGAGGG - Intergenic
1114582429 14:23774586-23774608 AGGTGTGCACAAAGGCAGGAAGG + Intergenic
1114859953 14:26504885-26504907 ATGTGTGTACAAAGGGAAAAGGG + Intronic
1114884194 14:26827292-26827314 CTATGTGCACAAGAGCAAAAGGG + Intergenic
1116419461 14:44716042-44716064 CTGTGTGCAGAAAGACTATAGGG - Intergenic
1117212378 14:53513908-53513930 ATGTGTGAACAAAGGCAGTACGG + Intergenic
1117252484 14:53951206-53951228 CTGTGGACACAAAGCCAAGGTGG - Intronic
1118907446 14:70032968-70032990 GTGTGTGCACACAGGGAAAAAGG - Intergenic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121191087 14:92030759-92030781 GTGTGTACACAAAGGCAACTGGG + Intronic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122113657 14:99517404-99517426 CTGATAGCACAGAGGCAAGAGGG + Intronic
1122462856 14:101910168-101910190 ATGTGGGCTCAAAGGCACGAGGG - Intronic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1126351111 15:47745596-47745618 CTGGGTCCACAGAGGCAAAATGG - Intronic
1126806063 15:52350553-52350575 CTGTGTGCACAAGGGCAGGGAGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127913292 15:63435837-63435859 ATGTGAGCTCAAAGGCAAAATGG + Intergenic
1127928916 15:63577454-63577476 CTGTCTGTACAAAGAAAAGAAGG + Intronic
1131227604 15:90638466-90638488 CTGTGGGCAGAAAGGAAAGTTGG - Exonic
1132444217 15:101896759-101896781 CTGTGAGCTCTAAGTCAAGAAGG - Intergenic
1132904916 16:2277667-2277689 CTGCCTGCACAAAGGAGAGACGG + Exonic
1132938688 16:2496172-2496194 CTTCGTGGACAAAGACAAGATGG + Exonic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1136220733 16:28826423-28826445 CTGTGTGCATAGAGGACAGAGGG + Intronic
1137319033 16:47359626-47359648 CTTTGTGGACAAAGGTAACAAGG - Intronic
1139469823 16:67172154-67172176 CCGTGTGAACAAAGCCAAGGCGG + Intronic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1140293887 16:73689400-73689422 CTATGTGCACAAAGTAAAGAGGG + Intergenic
1141624430 16:85253821-85253843 CTGTGTGTGCAAAGGCCAGGAGG + Intergenic
1142837196 17:2595210-2595232 CTGTGTGCTTAAAGGAGAGATGG - Intronic
1144118656 17:12127827-12127849 ATGTGTGCACAAAAGTAAGCAGG - Intronic
1145712410 17:26989772-26989794 CAGTGTGCACAAAGGTCACAGGG - Intergenic
1148326119 17:46784443-46784465 CCGTGTGCCCACAGCCAAGATGG - Intronic
1148385462 17:47231289-47231311 CTGTGAGAACAAAGCCAAGAAGG + Intergenic
1148959829 17:51384221-51384243 CTGTGTGCAAAAAGGAAACAGGG - Intergenic
1148980160 17:51566756-51566778 CAGTGTGGACGAAGGCAGGAAGG + Intergenic
1149531190 17:57396770-57396792 CTGTGTGCACAAAGGGCAGTGGG - Intronic
1152301034 17:79495466-79495488 AGGGGTGCAAAAAGGCAAGAAGG + Intronic
1152430526 17:80246220-80246242 CTGCGGGCACAAGGGGAAGATGG - Intronic
1152466177 17:80467868-80467890 CTGTGTTATCAAAAGCAAGAAGG + Exonic
1153450251 18:5219189-5219211 CTGTGTGCACAGAAGTCAGAAGG - Intergenic
1156393127 18:36671820-36671842 ATGTGTTCCCAAAGGCAACAAGG + Intronic
1156475058 18:37400687-37400709 CAGTATTCACAAAGGCAAGCTGG + Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157273964 18:46297142-46297164 CTGTGTACACATAGCCATGAGGG + Intergenic
1159013761 18:63084179-63084201 CTATGTGCTCAAAGTCTAGATGG - Intergenic
1159502273 18:69288842-69288864 CTGTGTGGAAAATGGCAAAAGGG + Intergenic
1159521623 18:69532216-69532238 CTCTGTTCAGATAGGCAAGAGGG - Intronic
1160641136 19:138056-138078 CTGTGAGCTCTAAGTCAAGAAGG + Intergenic
1162065113 19:8120831-8120853 CTGTGAGCTCCAAGGAAAGAGGG + Intronic
1162899032 19:13783295-13783317 CTGTGGGCACAAAGGCAGGGAGG - Intergenic
1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG + Intergenic
1166273179 19:41731147-41731169 CTGTTTGTTCAAAGGCAAGGTGG + Intronic
1166606520 19:44148213-44148235 TTGTGTGCACTGAGGCATGATGG + Intronic
1167773828 19:51541901-51541923 GTGTGTGAGCAAAGGCATGAAGG - Intergenic
925975883 2:9141834-9141856 CTGTGTGTACAAAGGCATAGTGG - Intergenic
926044763 2:9702497-9702519 CAATGTGTACAAAGGCAGGAAGG - Intergenic
926586781 2:14695444-14695466 CCTGGTGCACAAAGGCATGAGGG + Intergenic
927039695 2:19215983-19216005 CTGTGACCACAAATGGAAGAAGG - Intergenic
927807761 2:26162995-26163017 TAGTGTGCACAAAGTTAAGAGGG - Intergenic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929805603 2:45142397-45142419 CTGTGGGCACACAGCCTAGAAGG + Intergenic
931259230 2:60602607-60602629 CTGTGTGCCCAAATGTAAAAGGG + Intergenic
934900268 2:98154420-98154442 ATGTGTGCGCTAAGGGAAGAGGG - Intronic
935689837 2:105721033-105721055 CTGTGTGCTCACAGGGCAGAAGG + Intergenic
936647245 2:114386188-114386210 GTGTGTGCACAAGTGCATGAGGG + Intergenic
937496565 2:122426410-122426432 CTGTGTCCTCACAGGCAAGAAGG - Intergenic
938186187 2:129234085-129234107 CTGTGAGAAAAAAGGCAAGTGGG + Intergenic
938337165 2:130510430-130510452 CTGTGTCCACGCCGGCAAGAGGG + Intergenic
938352672 2:130610301-130610323 CTGTGTCCACGCCGGCAAGAGGG - Intergenic
939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG + Intronic
939680912 2:145130732-145130754 CTGTTTGGACAAAGGCATGCAGG + Intergenic
940006370 2:149012535-149012557 CTTTCTGCATCAAGGCAAGAAGG + Intronic
940939533 2:159542693-159542715 CTGAAAGCATAAAGGCAAGAAGG + Intronic
944539154 2:200740266-200740288 CCCTTTGCACCAAGGCAAGATGG + Intergenic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169193709 20:3672627-3672649 CTGGGACCAGAAAGGCAAGAAGG + Intronic
1170732053 20:18984338-18984360 CAGTGCGCACAAAGGCCAGAGGG - Intergenic
1173653306 20:44681515-44681537 ATGTGTGAACAAATGCAGGATGG + Intergenic
1174434874 20:50499069-50499091 CTGTGTGGACAAGAGCAACATGG - Intergenic
1176052584 20:63128197-63128219 CTGTGTTCACAGGGGCTAGAGGG - Intergenic
1177989808 21:28023457-28023479 CTTTGAAGACAAAGGCAAGAAGG - Intergenic
1179815131 21:43900736-43900758 CTGTGTGCTCAGTGGCCAGAGGG + Intronic
1180598245 22:16993952-16993974 GGGTGTTCACAAATGCAAGAAGG - Intronic
1180819696 22:18817594-18817616 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181118333 22:20648277-20648299 CTGAGTTCTCAAAGGCAAGATGG + Intergenic
1181205921 22:21252039-21252061 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1183499312 22:38168944-38168966 CTATATGGACAAAGGGAAGAAGG - Intronic
1183712144 22:39511306-39511328 TGGTGAGCGCAAAGGCAAGAAGG + Exonic
1203221000 22_KI270731v1_random:43374-43396 CGGTCTACACAGAGGCAAGAAGG - Intergenic
1203269825 22_KI270734v1_random:43447-43469 CGGTCTACACAGAGGCAAGAAGG + Intergenic
949800483 3:7898363-7898385 TGGTGTGCACAGAGACAAGAGGG - Intergenic
950357926 3:12427310-12427332 TTGAGTGCACATAGGCAAGGTGG - Intronic
952832421 3:37576213-37576235 CTGTGTGCCCAGCTGCAAGAAGG - Intronic
954497982 3:50983154-50983176 CTGTGTACCCAAAGTCCAGAGGG - Intronic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
955698554 3:61660507-61660529 CTATGTGAACAGAGGCGAGAGGG - Intronic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961362654 3:126377795-126377817 CTGTGACCTCAATGGCAAGAAGG + Intergenic
962493785 3:135919564-135919586 CTCTGAGCACAAATGCCAGAAGG + Intergenic
962529440 3:136265339-136265361 CTGACTGCAAACAGGCAAGAAGG - Intronic
963016235 3:140826762-140826784 CTGTGTAGGCAAAGGCAGGATGG - Intergenic
965475227 3:169147833-169147855 GTGTGTGCACCGAGGCAGGAGGG + Intronic
966476524 3:180354609-180354631 CTGTGGGGACAAAGGCAAAATGG - Intergenic
966856960 3:184201023-184201045 GGGTGTGCTCAAAGGCATGAGGG - Intronic
969293942 4:6258095-6258117 CAGTGAGCACAAAGGCCAGCTGG + Intergenic
970117940 4:12720358-12720380 GTGTGTGCTGAAAGACAAGATGG + Intergenic
970356511 4:15258994-15259016 CTGTATGCACAAATGCATGAAGG - Intergenic
970491553 4:16580259-16580281 CTTTGTGTACAAATGAAAGAAGG + Intronic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
971657975 4:29374238-29374260 GTGTGTGCACACAGACAGGAGGG + Intergenic
971700362 4:29965430-29965452 TTGTGTGCATATAGGCGAGAAGG - Intergenic
972315604 4:37922895-37922917 CTGTGTGAACGAAGACAATAAGG + Intronic
975040915 4:69743679-69743701 CTGGGTGCCCAAAGTCCAGAGGG + Intronic
975459063 4:74629324-74629346 CTGTGTGCATGAAGGAATGAAGG - Intergenic
977390158 4:96399020-96399042 CTGTGTGGACAGGGGAAAGAAGG - Intergenic
978879505 4:113684649-113684671 TTCTGGGCAGAAAGGCAAGATGG - Intronic
982208339 4:153014625-153014647 GTCTGTGCACACAGCCAAGATGG - Intergenic
982876462 4:160657390-160657412 CAGTGTGCAATAAGGCAAAAAGG - Intergenic
983095240 4:163553503-163553525 CTATGTGAACAAAGATAAGAAGG + Intronic
984242927 4:177239414-177239436 CTGTGAGCTCAAATGCATGAAGG - Intergenic
986798781 5:11238850-11238872 CTGTGATCACATAGCCAAGAAGG - Intronic
987418591 5:17691650-17691672 ATGTTTGGACAAGGGCAAGAAGG - Intergenic
988261531 5:28892525-28892547 AAGTGTACACAAAGGCAAAAGGG + Intergenic
989424001 5:41274707-41274729 CTGTGTCCAAAAAGGCTGGAAGG - Intergenic
989437817 5:41435103-41435125 CTATGTGTACAAAGGCACAAAGG + Intronic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
990738511 5:58889497-58889519 CTGTGTACACAAACACAAGCTGG + Intergenic
992745026 5:79811084-79811106 ATGTCTGGACAAAGGCCAGATGG + Intergenic
993915964 5:93742507-93742529 CTGTGTGCAGAAAGCTAAGGAGG + Intronic
994816693 5:104594824-104594846 GGATGTGCCCAAAGGCAAGAGGG - Intergenic
995386556 5:111595816-111595838 ATGTGTGCCCAAAGTCCAGATGG - Intergenic
995558708 5:113357645-113357667 CCATGTGCACTAAGGCAAAATGG + Intronic
996879334 5:128276867-128276889 CAGTGTGCACAAAAGCCAGGAGG - Intronic
998159742 5:139806663-139806685 ATGGGCTCACAAAGGCAAGAGGG + Intronic
998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG + Intronic
1001285311 5:170418744-170418766 CAGTGTGAACAAAGGCTAGGAGG - Intronic
1001891124 5:175339674-175339696 CTGTGACCTCAAAGCCAAGATGG + Intergenic
1002111651 5:176918736-176918758 CTATGTAAACTAAGGCAAGAAGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002736215 5:181388365-181388387 CTGTGAGCTCTAAGTCAAGAAGG - Intergenic
1002748483 6:86459-86481 CTGTGAGCTCTAAGTCAAGAAGG + Intergenic
1004075183 6:12338619-12338641 CTGTGTGCATGAAGGCATGTTGG - Intergenic
1004147000 6:13077276-13077298 CAGTTTCCACAAATGCAAGATGG - Intronic
1004943258 6:20584302-20584324 CAGTGTGCTTAAAGGCAAGGGGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1007352668 6:41285235-41285257 GTCTGTGCACAATTGCAAGAAGG + Intronic
1008513425 6:52298084-52298106 CTGTGTGAGCAAAGGCAATTGGG - Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1015118167 6:129671965-129671987 CTGTGTTCTCAGAGGCAAAATGG - Intronic
1018733063 6:166667894-166667916 CTGAGTGTACAAAGAAAAGAGGG + Intronic
1019241312 6:170663893-170663915 CTGTGAGCTCTAAGTCAAGAAGG - Intergenic
1019442221 7:1053153-1053175 CTCTGGGCACAGAGGCAAGCGGG + Intronic
1021402774 7:20228726-20228748 CTGTGTGAACATAGTCATGAAGG - Intergenic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1021958369 7:25849496-25849518 CAGTCTGAAGAAAGGCAAGACGG - Intergenic
1022110110 7:27224797-27224819 CTGTGTGCTCACAGGCAAACAGG - Intergenic
1022500502 7:30879600-30879622 CAGCGTGCACAAAGGCCAGGAGG - Intronic
1024350167 7:48355387-48355409 CAGAGTGCACAAGGGCAAGAGGG + Intronic
1026128542 7:67600986-67601008 CTCTGTGCACAAAAGCAATTTGG + Intergenic
1026148951 7:67771917-67771939 CTGGGTGGGCAAAGGCCAGAGGG + Intergenic
1027577701 7:79951342-79951364 CAGCGTGAACAAATGCAAGATGG - Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1030524309 7:110635199-110635221 CTGTGGGCACATAGGTAGGATGG - Intergenic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1032275056 7:130447131-130447153 CTGAGTGCTCAAAAGAAAGATGG + Intergenic
1033919197 7:146367687-146367709 CTGTGTTAGCAAAGGCAAAAAGG - Intronic
1033923934 7:146433217-146433239 CTGTGTGTACAAAGGCCCCAGGG - Intronic
1034518490 7:151600726-151600748 GTGAGTGAACAAGGGCAAGAAGG - Intronic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1035506805 8:144202-144224 CTGTGAGCTCTAAGTCAAGAAGG + Intergenic
1036093018 8:5689972-5689994 CTTTGTGTACAAAGGTAAGATGG + Intergenic
1036133735 8:6140083-6140105 CTGTTTACACAAAGGGAATAGGG - Intergenic
1037292085 8:17361495-17361517 CTGTGTTCTAAAAGGAAAGAAGG - Intronic
1037445312 8:18959598-18959620 GTGTGGGCAGAAAGGCAAGGTGG - Intronic
1037689918 8:21172935-21172957 CTGGGTGCACAAAAGTTAGAAGG - Intergenic
1042229545 8:66542222-66542244 CTCTGCCCACAAAGGCCAGATGG + Intergenic
1046512739 8:115219865-115219887 CCAGGTGAACAAAGGCAAGAAGG + Intergenic
1049862656 8:144910517-144910539 ATGTGAGCACAAAGGAAAGAGGG + Intergenic
1051432233 9:16991416-16991438 CTGAGTGTAGAAAGGCAAGCTGG - Intergenic
1052018512 9:23498282-23498304 CTGTGGGCTCCAAGGCATGAGGG + Intergenic
1053412533 9:37925055-37925077 ATGTGTGCCCAGAGGCCAGAGGG - Intronic
1054934687 9:70674109-70674131 CTGTCTGCCCACAGGAAAGAGGG + Intronic
1055023985 9:71699710-71699732 CAGTGTGCACAAATGCATGGGGG - Intronic
1057134295 9:92676210-92676232 CTGTGTTTAGAAATGCAAGATGG + Intergenic
1057985455 9:99708887-99708909 CTGTGTGCATACTAGCAAGAAGG - Intergenic
1058624475 9:106920392-106920414 ATGTGTACACAAAAGCAAGATGG + Intronic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG + Intergenic
1059998071 9:119933224-119933246 CTGCCTGCAGAAAAGCAAGAAGG - Intergenic
1060284778 9:122240012-122240034 CTGTGTGAATAAATGTAAGACGG - Exonic
1060637339 9:125209735-125209757 CTGTGTGTGCAAAGGCATGGAGG - Intronic
1061160955 9:128893453-128893475 CTGTGTCCTCAACTGCAAGATGG - Intronic
1061830042 9:133285905-133285927 CTGTAAGGACAAAGGAAAGAGGG - Intergenic
1062586069 9:137250679-137250701 CTGGGGGCACAGAGGCTAGAGGG - Intergenic
1203601504 Un_KI270748v1:13127-13149 CTGTGAGCTCTAAGTCAAGAAGG - Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1185758892 X:2674109-2674131 ATGTGTGAGCAAAGGCAGGAAGG - Intergenic
1187768602 X:22670455-22670477 CTGTGTCCTCAAAGGTAACATGG - Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192990777 X:76454009-76454031 CTGTGTGCTCAAACACTAGAGGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1195524795 X:105874316-105874338 CTGTGTGCCCAAAGGAAGTAGGG + Intronic
1196048702 X:111282496-111282518 CTGTGTGCAGAAGGGCAAGATGG - Intergenic
1197825905 X:130590114-130590136 ATGTGTGCACAAAGGTATGGAGG - Intergenic
1198812603 X:140550834-140550856 CTCTGTGCACAAAGGAAGGTTGG + Intergenic
1199787471 X:151117833-151117855 CTGTGAGCCCACAGGCAAGAAGG - Intergenic
1200274577 X:154719483-154719505 CAGCGTGCACAAAGGCATTAAGG + Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic