ID: 1121712017

View in Genome Browser
Species Human (GRCh38)
Location 14:96045496-96045518
Sequence CCTCATGGAGTGGAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121712007_1121712017 4 Left 1121712007 14:96045469-96045491 CCAGGGAGCCCGAAACCAGCCAG 0: 1
1: 0
2: 8
3: 49
4: 1103
Right 1121712017 14:96045496-96045518 CCTCATGGAGTGGAGTTGGATGG 0: 1
1: 0
2: 0
3: 20
4: 284
1121712010_1121712017 -5 Left 1121712010 14:96045478-96045500 CCGAAACCAGCCAGGTGACCTCA 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1121712017 14:96045496-96045518 CCTCATGGAGTGGAGTTGGATGG 0: 1
1: 0
2: 0
3: 20
4: 284
1121712009_1121712017 -4 Left 1121712009 14:96045477-96045499 CCCGAAACCAGCCAGGTGACCTC 0: 1
1: 0
2: 2
3: 20
4: 204
Right 1121712017 14:96045496-96045518 CCTCATGGAGTGGAGTTGGATGG 0: 1
1: 0
2: 0
3: 20
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121712017 Original CRISPR CCTCATGGAGTGGAGTTGGA TGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900154799 1:1199616-1199638 CCACAGGGAGGGGAGCTGGACGG - Intergenic
900661291 1:3785356-3785378 CCGGGTGGAGAGGAGTTGGAGGG - Intronic
903933265 1:26876830-26876852 ACCCATGGAGTGGAGATGGGTGG - Exonic
913944965 1:125152098-125152120 CATCATCGAGTGGAATTGAATGG - Intergenic
916712876 1:167427499-167427521 CCTCCTGGAGTGCAGGAGGAAGG - Intergenic
916735429 1:167603101-167603123 CCTCCCGGAGTGGATTTGGGTGG - Intergenic
917273683 1:173306419-173306441 CCTCAGGGACTGGAGTGAGATGG + Intergenic
920271746 1:204770233-204770255 CCCCATGTGGTGGAGTTGAATGG + Intergenic
1065352233 10:24805994-24806016 CCTCTTGTAGAGGAATTGGAAGG + Intergenic
1066744512 10:38593316-38593338 CCTCATCGAATGGAATTGAACGG + Intergenic
1066773967 10:38869912-38869934 CCTAATGGAATGGACTTGAATGG + Intergenic
1066778725 10:38919273-38919295 CCGAATGGAGTGGAGTGGAATGG + Intergenic
1066955741 10:42169498-42169520 CATCATCGAGTGGAATTGAATGG + Intergenic
1070966112 10:80532003-80532025 AGTCATGGAGTGAGGTTGGAAGG - Exonic
1071393857 10:85202181-85202203 ACTCCTGGTGTGGAGTGGGAAGG + Intergenic
1072501507 10:96022859-96022881 CCTGAGGGAGGGGAGTTGTAGGG + Intronic
1073215522 10:101834058-101834080 CCTCAAGGAGTAGATATGGAGGG - Intronic
1073812729 10:107168213-107168235 CCATATGAAGTGGGGTTGGACGG - Intergenic
1076731436 10:132440928-132440950 ACCCATGGAGTGGAGATGGCAGG - Intergenic
1077103989 11:833953-833975 CATCATGGAATGGAGCTGGAGGG - Intronic
1077680410 11:4235342-4235364 GCTGATGAAGTGGAGCTGGAAGG - Intergenic
1077684689 11:4280760-4280782 GCTGATGAAGTGGAGCTGGAAGG - Intergenic
1077690505 11:4337170-4337192 GCTGATGAAGTGGAGCTGGAAGG + Intergenic
1079837995 11:25358859-25358881 CCTCATGGAGAGGAATGGAAGGG + Intergenic
1080729001 11:34929053-34929075 CATGGTGGACTGGAGTTGGATGG + Intronic
1080750242 11:35144148-35144170 CCTGATGGAGAGGAGGTGGTTGG + Intronic
1081612673 11:44572225-44572247 CCTGATAGAGTAGAGTTGTAGGG - Intronic
1082918412 11:58464829-58464851 CCTTATGGGGTGAGGTTGGAGGG + Intergenic
1083991151 11:66246484-66246506 CCTCAAGGAGTGAAGAGGGATGG - Intergenic
1084966111 11:72745575-72745597 CCTCATGGGTTGGGGTAGGAGGG - Intronic
1087561157 11:99792628-99792650 CCTCATGGAATGAGGTAGGAGGG + Intronic
1088581534 11:111321202-111321224 TCTCTTGAAGTGGAGTGGGAAGG - Intergenic
1089975962 11:122731633-122731655 CCTAGTGGAATGGAGTTGGATGG + Intronic
1091269147 11:134293418-134293440 CGTCATGGAGATGAGTGGGAAGG + Intronic
1093270939 12:17060503-17060525 CTTCATATATTGGAGTTGGAGGG + Intergenic
1094663327 12:32493518-32493540 GCTAATGGAGTGGAGGTGGGTGG - Intronic
1095722564 12:45416656-45416678 CATCATGGAGTGGTGGTGGATGG - Intronic
1098306348 12:69106656-69106678 CTCCCTGGAGTGGAGTTGGAGGG - Intergenic
1098771791 12:74561829-74561851 CCCAATGCAGTGGTGTTGGAAGG + Intergenic
1100025731 12:90125575-90125597 CCTAATGAAGTGTAGTTGGTGGG + Intergenic
1103853057 12:123945988-123946010 CATCATGGACTGGAAATGGATGG - Intronic
1103939844 12:124495689-124495711 GGCCATGGAGTGAAGTTGGATGG - Intronic
1106371988 13:29143625-29143647 CCTCATAGAATGGAGTTGATGGG + Intronic
1108699339 13:52930502-52930524 CCTTCTGGGGTGGAGGTGGAGGG + Intergenic
1109814240 13:67559034-67559056 CCTCATGGAATCGATTGGGAAGG - Intergenic
1110674146 13:78219924-78219946 CCTGATGCAGTGGTGTTGGAAGG + Intergenic
1111682080 13:91455989-91456011 CTTCATGGATTGATGTTGGAGGG - Intronic
1112374981 13:98830741-98830763 CCTCATGGAGTGTAGTCTAATGG - Intronic
1118140403 14:63074135-63074157 CTTCTTGCAGTGGAGTTGTATGG - Intronic
1119514753 14:75239405-75239427 CATGATGGAGTGGCATTGGAAGG - Intronic
1119734943 14:76975895-76975917 CCTTAGGAAGTAGAGTTGGAGGG - Intergenic
1120765908 14:88326294-88326316 CTGCATGGAGTGGGGATGGAGGG + Intronic
1121232166 14:92365903-92365925 CAGCATGGAGTGGTGTTTGAAGG - Intronic
1121584650 14:95054916-95054938 CCACAGGGTGTGGAGGTGGAGGG - Intergenic
1121712017 14:96045496-96045518 CCTCATGGAGTGGAGTTGGATGG + Intronic
1122750260 14:103928045-103928067 CCTCAGGGTGAGGAGATGGAAGG - Intronic
1202874522 14_GL000225v1_random:195430-195452 TCTAATGGAGTGGAATTGAATGG + Intergenic
1128809127 15:70557282-70557304 CCAAATGGACTGGAGTAGGAGGG - Intergenic
1128896117 15:71375597-71375619 CCTCTGTGAGTGGAGTTGGAAGG + Intronic
1129712571 15:77827998-77828020 CCTGAAGGAGAAGAGTTGGAAGG - Intergenic
1135493092 16:22926653-22926675 CCTCATGGGGTAGAGTTCCAGGG + Intergenic
1135493662 16:22932526-22932548 ACTCAGGGAGGGAAGTTGGAGGG - Intergenic
1136006499 16:27333860-27333882 CCTGAAGTGGTGGAGTTGGAAGG - Intronic
1136474636 16:30505165-30505187 CCTCATGAAGGAGAGCTGGAGGG - Intronic
1136904082 16:34070871-34070893 CATCATGGAATGGACTTGAATGG + Intergenic
1136904803 16:34078704-34078726 CCTCATTGAATGGAATTGAATGG + Intergenic
1136905031 16:34081494-34081516 CATCATTGGGTGGAATTGGATGG + Intergenic
1136905515 16:34086576-34086598 CTTCATGGAATGGAATTGAATGG - Intergenic
1136940590 16:34572305-34572327 CATCATGGAATGGAATTGAAAGG + Intergenic
1136942663 16:34603772-34603794 CATCATAGAGTGGAATTGAATGG - Intergenic
1136946651 16:34659969-34659991 AATCATGGAATGGATTTGGATGG - Intergenic
1136946919 16:34663429-34663451 CCTCATGGAGTGGAATCGAATGG - Intergenic
1136950027 16:34705530-34705552 CATCATCGAGTGGAATTGAATGG - Intergenic
1136950544 16:34712589-34712611 CATCATCGAGTGGAATTGAATGG - Intergenic
1136950621 16:34713591-34713613 CATCATCGAATGGAGTTGAATGG - Intergenic
1136951586 16:34726392-34726414 CATCATGGAATGGAATTGAATGG - Intergenic
1136954405 16:34763923-34763945 CATCATGGATTAGAATTGGATGG - Intergenic
1136962505 16:34864587-34864609 CATCATGGAATGGAGTCGAATGG - Intergenic
1136968788 16:34947618-34947640 CATCATGGAATGGAATTGAACGG - Intergenic
1136999403 16:35216189-35216211 CCTCATGGGATGGACATGGAAGG + Intergenic
1137003552 16:35251817-35251839 CCTCATGGGATGGACATGGAAGG - Intergenic
1137017846 16:35394273-35394295 CCTCATGGGATGGACATGGAAGG - Intergenic
1137032132 16:35533138-35533160 CCTCATGGGATGGACATGGAAGG - Intergenic
1137086935 16:36137172-36137194 CATCATCGAATGGAGTTGAATGG - Intergenic
1137089425 16:36170128-36170150 CATCATGGAATGGAATTGAATGG - Intergenic
1137089842 16:36175613-36175635 CATCATGGAATGGAATTGAAAGG - Intergenic
1137090542 16:36184732-36184754 CATCATGGAATGGATTTGAAAGG - Intergenic
1137090882 16:36189145-36189167 CCTCATTGAATGGAATCGGATGG - Intergenic
1137091681 16:36199510-36199532 CATCATCGAGTGGAATTGAATGG - Intergenic
1137216751 16:46401158-46401180 CATCATCGAATGGAGTTGAATGG + Intergenic
1137217608 16:46412609-46412631 CATCATGGAATGGAATTGAACGG + Intergenic
1137218004 16:46418020-46418042 CATCAAGGAGTGGAATTGAATGG + Intergenic
1137521493 16:49199147-49199169 CCTAATGGACAGGAGTGGGAAGG + Intergenic
1137652959 16:50136094-50136116 CCTCATGGACAGGAATTTGAGGG + Intergenic
1138956187 16:61973054-61973076 CAACATGGATTGGAGTTGCAGGG + Intronic
1141855399 16:86677739-86677761 CCTCATGGTGTGGGGATGGCGGG - Intergenic
1142928981 17:3266394-3266416 CTTCATGGAGTAGGTTTGGAGGG - Intergenic
1143331960 17:6144073-6144095 CCTCATGGTCTGAAGTTGGCTGG - Intergenic
1144832967 17:18141955-18141977 CCTCCTGGAGCGGGGCTGGAGGG - Intronic
1145329806 17:21861896-21861918 CCTAATGGAATGGAGTTGAATGG + Intergenic
1145334666 17:21902229-21902251 CCGAATGGAGTGGAGTCGAATGG + Intergenic
1145703392 17:26850396-26850418 TCTAATGGAGTGGAATTGAAAGG + Intergenic
1145703954 17:26854981-26855003 CCTAATGGAATGGAATTGAATGG + Intergenic
1146392854 17:32438854-32438876 CCTCAGGGAGCCCAGTTGGAGGG - Intergenic
1146992723 17:37289797-37289819 CCTTAAGGGGTGAAGTTGGAAGG - Intronic
1148480100 17:47954399-47954421 CCACAAGGACAGGAGTTGGAAGG + Intronic
1150633178 17:66894620-66894642 GCTCATGGGGTGGAGGGGGAAGG - Intergenic
1152670284 17:81600045-81600067 CCTCATGAAGTGTGGCTGGAAGG + Intronic
1203185407 17_KI270729v1_random:112742-112764 CATCATGGAATGGAATTGAATGG - Intergenic
1203186124 17_KI270729v1_random:122077-122099 CATCATCGAGTGGAATTGAATGG - Intergenic
1203187770 17_KI270729v1_random:143799-143821 CCTCATCGAATGGAATTGAATGG - Intergenic
1203187968 17_KI270729v1_random:146367-146389 CATCATGGAATGGAATTGAAAGG - Intergenic
1203188189 17_KI270729v1_random:149238-149260 CCTCATAGAATGGAATTGAATGG - Intergenic
1157492512 18:48134359-48134381 CCTAATAGAATGGTGTTGGATGG - Intronic
1157937659 18:51891094-51891116 CCTCATGGGGAGGTGATGGAAGG + Intergenic
1160130166 18:76218354-76218376 CCTCATGCACTGGAACTGGAAGG - Intergenic
1161545537 19:4878142-4878164 CCCCAAGGAATGGAGTTGCAGGG - Intergenic
1161646175 19:5454813-5454835 CCTCCTGGACTTGATTTGGAGGG - Intergenic
1164401641 19:27906003-27906025 CCTCATGCAGTCCAGTGGGAAGG - Intergenic
1166203214 19:41252276-41252298 GATGATGGAGTGGAGGTGGAGGG + Intronic
1168509166 19:56960876-56960898 CCACATGGAAGGGACTTGGAGGG + Intergenic
1168630869 19:57955129-57955151 CCTCAAGGATTGAAGTTGCAGGG + Intergenic
1202668131 1_KI270709v1_random:18074-18096 CATCATCGAATGGAATTGGATGG - Intergenic
926696187 2:15771417-15771439 CCTCAGGGAGAGGAGGTGAAGGG + Intergenic
932431008 2:71673480-71673502 GCTCTTGGAGTGAAGTTGGGTGG + Intronic
932850273 2:75177878-75177900 CGTCATGTTGTGGAGCTGGAGGG - Intronic
933780431 2:85796982-85797004 CCTCAGGGAGGAGAGTGGGAAGG - Intergenic
934161099 2:89250435-89250457 CCTCACGTTGTGGAGGTGGAAGG - Intergenic
934169590 2:89329446-89329468 TCTCATGGAGTGGAGAAGAATGG + Intergenic
934190257 2:89784027-89784049 CCTCATCGAATGGAATTGAATGG - Intergenic
934190723 2:89790317-89790339 CGTCATGGAATGGAATTGAATGG - Intergenic
934193082 2:89817520-89817542 CATAATGGAGTGGAATAGGATGG - Intergenic
934197702 2:89853139-89853161 TCTCATGGAGTGGAGAAGAATGG - Intergenic
934206178 2:89931998-89932020 CCTCACGTTGTGGAGGTGGAAGG + Intergenic
934253474 2:90385085-90385107 CATCATGGAATGGAATTGAATGG + Intergenic
934253968 2:90391169-90391191 CATCATGGAATGGAATTGAATGG + Intergenic
934254502 2:90397809-90397831 CATCATGGAATGGAATTGAATGG + Intergenic
934254671 2:90400006-90400028 CCTCATTGAGTGGAATCGAATGG + Intergenic
934254959 2:91403584-91403606 CATCATTGAATGGAATTGGATGG + Intergenic
934255079 2:91405247-91405269 CCTCATTGAATGGAATTGAATGG + Intergenic
934255798 2:91414808-91414830 CATCATTGAGTGGAATTGAATGG + Intergenic
934256037 2:91418101-91418123 CCTCATTGAATGGAATTGAATGG - Intergenic
934256157 2:91419764-91419786 CATCATTGAATGGAATTGGATGG - Intergenic
934256395 2:91423007-91423029 CATCATCGAATGGAATTGGATGG - Intergenic
935346591 2:102113773-102113795 CATCATGGGGAGGAGATGGATGG - Intronic
935672888 2:105570712-105570734 CCTCTTGGAGTGGGGTTTGGGGG + Intergenic
935981550 2:108633015-108633037 CTTCCTGGAGTGGAGGGGGAAGG - Intronic
936049470 2:109212242-109212264 CCTCATTTCATGGAGTTGGAGGG - Intronic
936787912 2:116117615-116117637 CATGATAGAGTTGAGTTGGAGGG - Intergenic
939390561 2:141563865-141563887 ACTCATGGAGAGGAGAGGGAGGG + Intronic
944041497 2:195360425-195360447 TCTCAAGAAATGGAGTTGGAGGG - Intergenic
944076757 2:195741502-195741524 CCTCATGGATTGGAGTCTGCAGG + Intronic
944538215 2:200732019-200732041 CCTCAGGGAGCGGCGATGGATGG + Intergenic
947175897 2:227367217-227367239 CCTCTTGGGGTGGAGGTGGGTGG + Intronic
947306439 2:228753550-228753572 CCTCATGCCCTGGAGTTGAAAGG + Intergenic
947356560 2:229301945-229301967 CCTCATTGAATACAGTTGGATGG + Intergenic
948146630 2:235713020-235713042 AATCTTGGAGTGGAGTGGGAAGG - Intronic
1168796186 20:611547-611569 GCGCAGGGAGTGGAGTTGAAAGG + Intergenic
1168891715 20:1299334-1299356 CCTCAAGGAGCAGAGTTGGATGG + Intronic
1170807080 20:19641628-19641650 CCTCATGGGGTGCAGCAGGAGGG + Intronic
1171919588 20:31087715-31087737 CATAATGGAATGGAGTTGAATGG + Intergenic
1171928086 20:31205874-31205896 CATAATGGAATGGAGTTGAATGG + Intergenic
1172008314 20:31832115-31832137 CCTCATGAAGAGGCGCTGGAAGG + Exonic
1172536071 20:35674337-35674359 CCTCAGGGAGGTGAGCTGGACGG - Exonic
1173870490 20:46338969-46338991 ACTCCTGGAGTGGAGATGGATGG + Intergenic
1175758217 20:61543849-61543871 CCTGATGGAATGGAGCTGGCAGG + Intronic
1176746877 21:10659929-10659951 CCTAATGGAATGGAATTGAATGG - Intergenic
1178371435 21:32030516-32030538 CCGGATGGAGTGGACCTGGATGG - Intronic
1178514670 21:33236516-33236538 CCCCATGGACTGGAGTCAGAGGG - Intronic
1179176922 21:39014727-39014749 CTTCATGGAGTGGAGGTGTGTGG + Intergenic
1179768272 21:43591804-43591826 CCTGATGGGATGGAGTGGGATGG - Intronic
1180526325 22:16265655-16265677 CATCATCGAGTGGAGTCGAACGG - Intergenic
1180526346 22:16265975-16265997 CATCATTGAATGGAGTTGAATGG - Intergenic
1180527722 22:16311909-16311931 CATCATCGAGTGGAGTCGAATGG - Intergenic
1180533094 22:16367192-16367214 CATCATCGAATGGAGTTGAATGG + Intergenic
1180534031 22:16379609-16379631 CATCATAGAGTGGAATTGAATGG + Intergenic
1180534183 22:16381466-16381488 CATCATGGAATGGAGTGGAATGG + Intergenic
1183210849 22:36450159-36450181 TCTGATGGTGGGGAGTTGGAGGG + Intergenic
1184473754 22:44710043-44710065 CCTCATGCTGGGGAGGTGGAGGG + Intronic
1185022978 22:48391191-48391213 CACCATGGAGCGGAGATGGACGG + Intergenic
1203297762 22_KI270736v1_random:55220-55242 TCTAGTGGAGTGGAGTTGAATGG + Intergenic
1203301223 22_KI270736v1_random:78449-78471 CCTAGTGGAGTGGAGTGGAATGG + Intergenic
1203311925 22_KI270736v1_random:148753-148775 CGGAATGGAGTGGAGTTGAATGG + Intergenic
1203315460 22_KI270737v1_random:4330-4352 CATCATGGAATGGAGTGGAATGG - Intergenic
1203315612 22_KI270737v1_random:6187-6209 CATCATAGAGTGGAATTGAATGG - Intergenic
1203316549 22_KI270737v1_random:18604-18626 CATCATCGAATGGAGTTGAATGG - Intergenic
1203322077 22_KI270737v1_random:75214-75236 CATCATCGAGTGGAGTCGAATGG + Intergenic
1203327151 22_KI270738v1_random:35890-35912 CATCATGGAGTGGAATCGAATGG + Intergenic
1203327378 22_KI270738v1_random:38742-38764 CATCATGGAATGGAATTGAAAGG + Intergenic
1203327641 22_KI270738v1_random:42015-42037 CCTCATGGGGTGGAATCGAATGG + Intergenic
1203328363 22_KI270738v1_random:52002-52024 CATCATTGAGTGGAATTGAATGG + Intergenic
1203328642 22_KI270738v1_random:55507-55529 CATCATAGAATGGAATTGGATGG + Intergenic
1203328670 22_KI270738v1_random:55840-55862 CCTCATCGAATGGAATTGAATGG + Intergenic
1203329764 22_KI270738v1_random:69972-69994 CCTCATCGAATGGAATTGAATGG + Intergenic
1203330241 22_KI270738v1_random:76248-76270 CATCATGGAATGGAATTGAATGG + Intergenic
1203330516 22_KI270738v1_random:79902-79924 CATCATGGAATGGAATTGAATGG + Intergenic
950895742 3:16449091-16449113 CCTTGGGGAGTGGAGTGGGAAGG + Intronic
951339058 3:21461777-21461799 GCTCATGGAGAGGATATGGATGG + Intronic
952190109 3:31014157-31014179 CCTCATGGACTGCAGTTAAATGG - Intergenic
954050594 3:47973061-47973083 CCTTATGGACTGGATTTGGTTGG - Intronic
954274525 3:49533486-49533508 CCATGTGGAGTGGAGGTGGAGGG + Exonic
955778824 3:62462343-62462365 TCTCTTGGAGAGGAGCTGGAGGG - Intronic
956900086 3:73706606-73706628 AGTGGTGGAGTGGAGTTGGAGGG - Intergenic
957262033 3:77914335-77914357 CCACATCCAGTGGAATTGGAAGG - Intergenic
957994672 3:87673772-87673794 ACTCATGGAGTGGAGGTGGGAGG - Intergenic
959650637 3:108747252-108747274 TTGCATGGAGTGGAGTTGCATGG - Intronic
960294360 3:115925082-115925104 CCTCAAAGAGTGGACTTGGAAGG - Intronic
964787382 3:160413040-160413062 ACTCATGAAGTGGAGGTGGGAGG - Intronic
965726395 3:171721065-171721087 CCTCATGGAGTTCTGTTAGAGGG - Intronic
966212655 3:177469283-177469305 CCTGGTGGAGTAGAGGTGGAAGG + Intergenic
966637169 3:182148282-182148304 TCTCATGGAGTTGGGTTGGGGGG + Intergenic
967977891 3:195045634-195045656 CCGCATGGAGTGAGGGTGGAGGG - Intergenic
968068884 3:195773842-195773864 CCTCCTGGAGCAGAGTTGGAGGG - Intronic
968939594 4:3631053-3631075 CCTCCTGGGGTGGGGTGGGAGGG + Intergenic
968940875 4:3636962-3636984 CATCATGGGGTGGTGATGGAAGG + Intergenic
969615597 4:8250980-8251002 CCTCATGGAGTGGAGGAGCTGGG - Intergenic
970200297 4:13598011-13598033 CCTCATGGGCTGGACTTGAAGGG - Intronic
972342618 4:38165679-38165701 CATGATGGAGGGGAGTTGAAGGG - Intergenic
973197109 4:47457773-47457795 CCTCATGGAATGAATTGGGAAGG - Intronic
973633062 4:52837710-52837732 CCTCATGGAGCTGAGTTTGCAGG + Intergenic
973900466 4:55464912-55464934 CTTCATGGAGTGGGCTTGGAGGG - Intronic
974630031 4:64477620-64477642 CATCATGAACTAGAGTTGGATGG - Intergenic
975503850 4:75116985-75117007 ACTCATGGAGAGGAGAGGGAAGG + Intergenic
982134480 4:152260196-152260218 TATCTTGGAGTGGAGTTGGCAGG - Intergenic
985750518 5:1671392-1671414 CCTCATAGGTTGAAGTTGGAGGG + Intergenic
986104986 5:4650988-4651010 CCTGTGGGAGGGGAGTTGGACGG + Intergenic
986274010 5:6257781-6257803 GCTAATGGACTGGAGCTGGAGGG - Intergenic
989383944 5:40836099-40836121 ACTCAGGGGGTGGAGGTGGAGGG + Intergenic
989911361 5:49658842-49658864 CCTAATGGAATGGAGTGGAATGG - Intergenic
994094000 5:95832472-95832494 CCTCTTGGAGTAGAGAGGGATGG - Intergenic
999274359 5:150319163-150319185 CCTCCTGGAATGCAGCTGGAGGG - Intronic
999615732 5:153421131-153421153 TCTCATGGGGTGGTGTAGGAAGG - Intergenic
999708659 5:154296700-154296722 CCAGATGGAGTGGAGTTCCAAGG - Intronic
1000433816 5:161183297-161183319 ACTCATGGAGAGGAGAAGGATGG + Intergenic
1005274011 6:24197263-24197285 CCTCAGGAAGGGGAGTTGGGAGG - Intronic
1005987409 6:30883693-30883715 CCCAACGGAGTGGAGTGGGAGGG - Intronic
1006512305 6:34528336-34528358 CCCCATGGAATGGGGTCGGAGGG - Intronic
1006513249 6:34532869-34532891 CAGCCTGGAGTGGAGTGGGACGG - Exonic
1008598609 6:53066332-53066354 CCTGGCGGAGTGGGGTTGGAGGG + Intronic
1013351484 6:109309957-109309979 CATCTAGGACTGGAGTTGGAAGG + Intergenic
1013416966 6:109934009-109934031 CCTCATGGAGTGCTGCCGGAGGG + Intergenic
1016299441 6:142614045-142614067 CCCCATGGGCTTGAGTTGGAGGG + Intergenic
1016473139 6:144396789-144396811 CCTCATGACATGCAGTTGGATGG - Intronic
1016975498 6:149803524-149803546 TCTCATGGAAGGGAGTGGGAAGG - Intronic
1018804549 6:167248750-167248772 CCTCATGGCGTGGGGTAGGGAGG + Intergenic
1020511301 7:9060755-9060777 GCTTATTGAGTGGAGGTGGAGGG - Intergenic
1021142242 7:17040975-17040997 CTTCCTGGAGTGGAATTAGAAGG - Intergenic
1021693604 7:23254408-23254430 GCTCATGGAGTGCAGTGGCAAGG - Intronic
1021940785 7:25677203-25677225 CCTCATTGAGAAGTGTTGGATGG - Intergenic
1023172607 7:37404282-37404304 CCACACGGAGTGAAGGTGGAAGG - Intronic
1025025259 7:55511273-55511295 CCTCAGGGAGAGCAGTCGGACGG + Intronic
1025317020 7:58044280-58044302 CATCATCGACTGGAGTTGAATGG + Intergenic
1025317044 7:58044624-58044646 CATCATCGAGTGGATTTGAATGG + Intergenic
1025475982 7:60921783-60921805 CATCATGGAATAGAATTGGATGG - Intergenic
1025476177 7:60924330-60924352 CATCATGGAATAGAATTGGATGG - Intergenic
1025476855 7:60933391-60933413 CATCATTGAGTGGAATTGAATGG - Intergenic
1025484049 7:61023959-61023981 CATCATCGAATGGAATTGGATGG - Intergenic
1025556422 7:62314871-62314893 CATCATTGAATGGAATTGGATGG + Intergenic
1025559026 7:62347015-62347037 CATCATTGAGTGGAATTGAATGG + Intergenic
1026428788 7:70323393-70323415 CCTCATGAAGTGGTATTGGAAGG + Intronic
1027997752 7:85447567-85447589 CCTCTTGGAGTAGAATTGGTTGG - Intergenic
1030738808 7:113084182-113084204 CCTGAAGGAGCGGTGTTGGAAGG + Exonic
1033204357 7:139404727-139404749 ACTCATAGAGTGGAGTTGCCAGG + Intronic
1034416155 7:150965289-150965311 CCACATGCAGTGGATTTGGGTGG - Intronic
1035366353 7:158351304-158351326 GCTCATGGGGTGCAGTAGGAGGG - Intronic
1040332083 8:46390874-46390896 CGTCATAGAGTGGCGTTGGCGGG + Intergenic
1042080915 8:65049970-65049992 CCTCTTTGACAGGAGTTGGAAGG + Intergenic
1042089961 8:65148156-65148178 CCTCATGGAGGGTAGCTGTAGGG - Intergenic
1042296823 8:67228446-67228468 TCACATGGAGTAGAGGTGGAGGG - Intronic
1043304979 8:78782907-78782929 CCACATGCAGTGAAGATGGATGG + Intronic
1044178007 8:89153750-89153772 CCTCCAAGAGTGGAATTGGAAGG + Intergenic
1044884815 8:96765987-96766009 CCTCATGGTTTGGAGTGGGAGGG - Intronic
1048918511 8:139206683-139206705 CCTCATGGGATGGAGTAGGATGG - Intergenic
1053434277 9:38065251-38065273 CCTGATGGGGTGGAGGTGGAGGG + Intronic
1053947204 9:43323288-43323310 CATCATCGAGTGGAATTGAAAGG - Intergenic
1053947888 9:43333429-43333451 CATCATCGAGTGGAATTGAATGG - Intergenic
1054451178 9:65404279-65404301 CCTCCTGGGGTGGGGTGGGAGGG - Intergenic
1055505069 9:76939777-76939799 CCACATGGGGTGGGGTAGGAGGG - Intergenic
1055956117 9:81775232-81775254 TTTCATGGAGATGAGTTGGATGG + Intergenic
1060861212 9:126956319-126956341 CCTCAGGGACTGAAGTTGGATGG + Intronic
1061694896 9:132365380-132365402 CCTCATTGCGTGGAATTGGATGG + Intergenic
1062114223 9:134798984-134799006 CCCCCTGGATTGGAGCTGGAAGG - Intronic
1062307006 9:135913291-135913313 CCTTCTGGGGAGGAGTTGGATGG + Intergenic
1062334818 9:136060500-136060522 CCTCAGGGAGGGGAGAGGGATGG - Intronic
1203729909 Un_GL000216v2:80924-80946 TCTAATGGAGTGGAATTGAATGG - Intergenic
1203344763 Un_KI270442v1:25885-25907 CGGAATGGAGTGGAGTGGGATGG + Intergenic
1203590334 Un_KI270747v1:51846-51868 CATCATCGAGTGGAATTGAAAGG - Intergenic
1203678829 Un_KI270756v1:46396-46418 CCTAATGGAATGGACTTGAATGG - Intergenic
1188218157 X:27504659-27504681 ACTCATGGAGTGGATATGGGAGG + Intergenic
1190218398 X:48495255-48495277 CCTCATGGACTGGGACTGGAAGG + Intergenic
1197968153 X:132086794-132086816 CAGGATGGAGTGGGGTTGGATGG - Intronic
1198112295 X:133512618-133512640 CGACATGGATTGGAGGTGGAGGG - Intergenic
1201100114 Y:10665108-10665130 TGTAATGGAGTGGAGTTGAATGG - Intergenic
1201102613 Y:10689518-10689540 TGTAATGGAGTGGAGTTGAATGG - Intergenic
1201106911 Y:10770140-10770162 CATAATGGAGTGGAGTGGAATGG - Intergenic
1201118359 Y:10851932-10851954 TGTAATGGAGTGGAGTTGAATGG - Intergenic
1201119793 Y:10864114-10864136 CCTAATGGAGTGGATTTGTTTGG - Intergenic
1201120927 Y:10873004-10873026 ACTAATGGAGTGGAGTGGAACGG - Intergenic
1201128773 Y:10936906-10936928 TGGAATGGAGTGGAGTTGGATGG - Intergenic
1201130944 Y:10951552-10951574 AATCATGGAGTGGAGTGGAATGG - Intergenic
1201132099 Y:10960226-10960248 CGAAATGGAGTGGAGTTGAATGG - Intergenic
1201196850 Y:11502784-11502806 TGTCATGGACTGGAGTTGAATGG + Intergenic
1201199232 Y:11524214-11524236 TCAAATGGAGTGGAGTTGAATGG + Intergenic
1201208370 Y:11654407-11654429 CCGAATGGAATGGAATTGGATGG + Intergenic