ID: 1121713397

View in Genome Browser
Species Human (GRCh38)
Location 14:96055707-96055729
Sequence TGAAGCCTCCTCACCGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121713396_1121713397 15 Left 1121713396 14:96055669-96055691 CCAGAAGTTCTGTAAGGGACTCT 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1121713397 14:96055707-96055729 TGAAGCCTCCTCACCGTGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 138
1121713393_1121713397 23 Left 1121713393 14:96055661-96055683 CCTATCTTCCAGAAGTTCTGTAA 0: 1
1: 0
2: 2
3: 21
4: 246
Right 1121713397 14:96055707-96055729 TGAAGCCTCCTCACCGTGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121713397 Original CRISPR TGAAGCCTCCTCACCGTGCC TGG Intronic
901599015 1:10407868-10407890 TGCAGCCTCCTCAACCTCCCAGG - Intronic
904366234 1:30012557-30012579 AGCAGCCTCCTCTCCCTGCCTGG + Intergenic
915543449 1:156582880-156582902 TGAACCCTCCACACCCAGCCTGG - Intronic
915661987 1:157412201-157412223 TGATGCCTCCCCACTGTGCAAGG - Intergenic
920296310 1:204959310-204959332 TGAAGCCAGGTCACCCTGCCAGG - Intronic
920432626 1:205928451-205928473 TGAAGCATCCACTCTGTGCCAGG - Intronic
922767470 1:228163415-228163437 TCCAGGCTCCTCACCATGCCCGG + Intergenic
924402904 1:243706754-243706776 TGAAGCCTGAGCACAGTGCCTGG - Intronic
1062911061 10:1212729-1212751 TGAGTCCACCTCACCGTGGCAGG + Intronic
1064871139 10:19938169-19938191 TCAAGCCTCCCCACTGTGCTAGG - Intronic
1074703208 10:116110172-116110194 TGAAGTCTCATCCCCCTGCCAGG - Intronic
1075776624 10:124993251-124993273 TGACGCCTGCTCACTGTACCAGG + Exonic
1077372878 11:2191943-2191965 TGACCCCTCCTCCCCGAGCCTGG + Intergenic
1080304933 11:30825986-30826008 TGGAGCCTCCTCCAGGTGCCAGG - Intergenic
1080584546 11:33669342-33669364 GGAAGCCAACTCACCATGCCAGG - Exonic
1081409156 11:42735345-42735367 TGAATACTCTTCTCCGTGCCCGG - Intergenic
1086243202 11:84720711-84720733 TGAACCCTCCTCTAAGTGCCTGG - Intronic
1090189339 11:124758412-124758434 TGAAGACACCTCCCCGTGCAAGG + Exonic
1091174644 11:133547064-133547086 TGCAGCCTCCTCACCTTGTGCGG + Intergenic
1092669579 12:10847993-10848015 TGAAGCCACATAACCGTGCGGGG + Intronic
1094207669 12:27857931-27857953 TGAAGCCACCTCCCAGTGCAAGG + Intergenic
1096523398 12:52196762-52196784 TTAAGCCTCCTCCACATGCCAGG + Intergenic
1099649328 12:85404436-85404458 TGAAGCCTTCTCAGAGTTCCAGG - Intergenic
1099955306 12:89347482-89347504 CTAAGCTTCCTCACCGTGTCAGG - Exonic
1102034342 12:109762239-109762261 TGCACCCTCCCCACTGTGCCCGG - Intronic
1103339940 12:120215906-120215928 TGAGGCCTCATCACTGAGCCCGG - Intronic
1104653476 12:130555940-130555962 TGCTGCCTCCTCTCCGTGCCTGG - Intronic
1105475044 13:20721675-20721697 TGAAGCCTACTGCCTGTGCCGGG + Exonic
1108112282 13:47087986-47088008 TGAAGACTCATCACCAAGCCAGG - Intergenic
1111041641 13:82756992-82757014 TGCAGCCTCCACTCCATGCCTGG + Intergenic
1114657781 14:24326285-24326307 TGAGGCCTCCTCACCGATCCAGG + Exonic
1118885814 14:69865125-69865147 TGAATCCCCCACACTGTGCCTGG - Intronic
1121713397 14:96055707-96055729 TGAAGCCTCCTCACCGTGCCTGG + Intronic
1124342751 15:28900743-28900765 TGCAGCCTCTTCACCCTGCAGGG + Intronic
1124356148 15:28996338-28996360 AGAGGCCTCCTCATCTTGCCAGG + Intronic
1127959839 15:63882540-63882562 GGCAGCCTCCTCAGCCTGCCAGG - Intergenic
1128749578 15:70139498-70139520 TGAAGCTCCGTCAGCGTGCCCGG - Intergenic
1129170306 15:73803570-73803592 TGGAGCCGCCTCTCTGTGCCAGG - Intergenic
1129275285 15:74441422-74441444 TCAAGCATCCTCTCTGTGCCAGG - Intergenic
1131814621 15:96209320-96209342 TGAAGCCTCCTGGATGTGCCTGG - Intergenic
1131861071 15:96653673-96653695 CTAAGCCTGCTCACCCTGCCTGG - Intergenic
1133201378 16:4206581-4206603 TGAAGCCACCTCCCCGGGCCGGG + Intronic
1134019077 16:10908984-10909006 TCTAGCCTGGTCACCGTGCCTGG + Intronic
1134229630 16:12418900-12418922 TGAAGCTTTCTCTCCTTGCCAGG + Intronic
1135884697 16:26295422-26295444 TTAAGCCTCCTTTCCATGCCTGG + Intergenic
1136084416 16:27874524-27874546 TGCAGCCTCCTCAACCTCCCAGG + Intronic
1136588342 16:31202123-31202145 TGAGGCCTCCACACCCAGCCCGG - Intronic
1142648942 17:1333916-1333938 TGCAGCCTCCTCAACCTCCCAGG + Intergenic
1148053311 17:44779717-44779739 TGATGCCCCCTCTCCGTTCCAGG + Exonic
1150105903 17:62462274-62462296 TGCAGCCTCCTCCCCATGACAGG - Intronic
1152309404 17:79540464-79540486 AGAATCCTCCTCAGCGTGTCAGG + Intergenic
1152640959 17:81449005-81449027 TGACGCCTCCTCATGCTGCCAGG - Intronic
1152657648 17:81527425-81527447 TGGGCCCTGCTCACCGTGCCTGG - Intergenic
1155025978 18:21941350-21941372 TGAGGCTTCCTCCCTGTGCCAGG + Intergenic
1157124386 18:44942234-44942256 TGAAGCCTCCCCACTCTGTCTGG + Intronic
1160141258 18:76325255-76325277 TGGAGCCACCTCACCCTACCGGG - Intergenic
1160737084 19:667828-667850 TGGAGCCTCCGCTCTGTGCCAGG + Intergenic
1161063512 19:2226827-2226849 GGAAGCCTCCTCAGCGGCCCCGG + Exonic
1162348814 19:10136835-10136857 TGTAGCCTCCTCAACCTCCCAGG + Intronic
1163154265 19:15431615-15431637 TGAAGCCACCTCCCTGTCCCTGG - Intronic
1163809943 19:19424757-19424779 GGAAGCATCCTCACCTTTCCAGG + Intronic
1166731580 19:45062032-45062054 AGCAGCCCCCTCACTGTGCCAGG + Intronic
1167841831 19:52128279-52128301 TGAAACCTCCTCACAGTCCAAGG - Intronic
1168252387 19:55148014-55148036 TGCAGCCTCCTGGCTGTGCCAGG - Intronic
1168314896 19:55480714-55480736 TAAAGCCTCCTCATGGGGCCAGG - Intronic
1168466766 19:56608639-56608661 TGTAGCCCCTTCACTGTGCCAGG - Intronic
925060161 2:884789-884811 TGAAGCCTCCACACCCTCTCAGG - Intergenic
925354090 2:3224940-3224962 TGAAGCCACATCAGGGTGCCGGG + Intronic
926304607 2:11628883-11628905 TCAAGCCCCCTCACCGTCCCAGG - Intronic
929860091 2:45669475-45669497 TGAAGCCTCTGCTCTGTGCCTGG + Intronic
930238885 2:48915606-48915628 TGACGCCTGCTCACTGTACCAGG + Intergenic
933996701 2:87675495-87675517 TGAGGCCTCCTGGCCGAGCCAGG + Intergenic
936297152 2:111275415-111275437 TGAGGCCTCCTGGCCGAGCCAGG - Intergenic
938573319 2:132582430-132582452 TGAAGCCTGCTCTCAGTGGCTGG + Intronic
938581306 2:132648893-132648915 TCATGCCTCCTCAGGGTGCCTGG - Intronic
938969574 2:136419893-136419915 TGAGGTCTCCTCACCATCCCAGG - Intergenic
939630612 2:144523319-144523341 TGCATCCTTCTCACCCTGCCTGG - Intronic
944208391 2:197181511-197181533 TGAAACTTCCTCTCCATGCCTGG - Intronic
945524018 2:210866138-210866160 TGTCTCCTCCTCACCGTGGCGGG + Intergenic
948544882 2:238720400-238720422 TGAAGCCTTCTCACGGTGCAGGG + Intergenic
1172876047 20:38165057-38165079 AGACGCCTCCTCACCCAGCCCGG + Intronic
1173440913 20:43075318-43075340 AGAGGACTCTTCACCGTGCCAGG - Intronic
1175886824 20:62296935-62296957 TGCAGCCTTCTCACCGGGCGAGG + Intergenic
1176076693 20:63251878-63251900 TCAGGCCTCCCCATCGTGCCCGG + Intronic
1178829046 21:36039974-36039996 TGAAGGCTGCTCTCCCTGCCAGG + Intronic
1179190562 21:39118802-39118824 TGAAGCCGCCTCCCCATGGCGGG - Intergenic
1179889932 21:44330357-44330379 GGAAGCAGCCTCGCCGTGCCGGG - Intronic
1180985204 22:19900096-19900118 TGCAGCTTCCTCACTGTGGCTGG + Intronic
1182349408 22:29690771-29690793 TGAAGCCTCCGCACCAGGCATGG - Intronic
1183813832 22:40281926-40281948 TCATGCCTCCTCACCTTGCCAGG + Intronic
952967576 3:38630780-38630802 TGACCCCTCCTCACCCTGCATGG + Intronic
961114864 3:124320508-124320530 AGAAGCCTCCTCCCCATGCTGGG - Intronic
967028248 3:185582981-185583003 TGAAGCCTTCTCACTCTTCCTGG + Intronic
970443744 4:16107256-16107278 TGCAGCCTCCTGACAGGGCCAGG + Intergenic
971946692 4:33287497-33287519 AGACTCCTCCTCACCTTGCCTGG + Intergenic
976206514 4:82627612-82627634 GGAAGCCTCATCCCAGTGCCTGG - Intergenic
976488745 4:85641793-85641815 TGAAGCTTCCACACCCTTCCTGG + Intronic
978338094 4:107691277-107691299 TAAAGCCTCAGCACAGTGCCTGG - Intronic
987050194 5:14142857-14142879 AGAAGCCCCCTCCCCGAGCCAGG + Intergenic
987443650 5:17988272-17988294 TGAAGCAGCTTCACAGTGCCTGG - Intergenic
992993271 5:82307039-82307061 TGAAGACCTCACACCGTGCCTGG - Intronic
995805380 5:116046550-116046572 TGAGGCCTCCACACCTTGCCAGG + Intronic
995833206 5:116376187-116376209 TGTATCCTCCTCTCTGTGCCCGG + Intronic
996540056 5:124621424-124621446 TTAAGCCTGCTTACCGTTCCTGG + Intergenic
997601504 5:135141695-135141717 TGGAGCCTCCCCATCGTGACAGG - Intronic
999345032 5:150810318-150810340 TCCAGCATCCTCACCTTGCCTGG + Intergenic
1002346500 5:178551674-178551696 TCAACCCTCCTCCCCGTGCCTGG + Intronic
1002421620 5:179152128-179152150 TGATGCTGCCTCACCTTGCCAGG + Exonic
1002598163 5:180337656-180337678 TGAAGCCACCTCACTGAGGCAGG + Intronic
1003254906 6:4466503-4466525 TGATGGCTCCTAACAGTGCCAGG - Intergenic
1003311147 6:4970960-4970982 TGACCCCTCCTCGCTGTGCCTGG - Intergenic
1003515971 6:6818954-6818976 TGAAGCCTCAGAACAGTGCCTGG + Intergenic
1005385325 6:25279550-25279572 TGACGCCTCCTCGCAGTTCCCGG - Exonic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1006934630 6:37708729-37708751 TGCAGCTTCCTCGCTGTGCCAGG - Intergenic
1007312155 6:40955140-40955162 GGAAGCCTCCACTCCGGGCCTGG + Intergenic
1007658545 6:43467880-43467902 AGCACCCTCCTCACCATGCCAGG + Intergenic
1008424584 6:51342277-51342299 TGAAGCCTTCTCCCCTTGCCAGG + Intergenic
1012131435 6:95498017-95498039 TGAAGCTTCCACACTGTGCAAGG - Intergenic
1012931109 6:105317770-105317792 CACAGCTTCCTCACCGTGCCAGG + Intronic
1014074564 6:117221481-117221503 TGAATCCTGCTCATAGTGCCAGG + Intergenic
1014749306 6:125237061-125237083 TCCAGCCTCCTCACTGTCCCTGG - Intronic
1015903370 6:138090431-138090453 TGAAGCCTCCTCCTTGTGCTGGG - Exonic
1017971568 6:159316143-159316165 TGCAGCCTCCTGACCTGGCCAGG - Intergenic
1018475877 6:164141024-164141046 TGGAGCCTCATCACTGAGCCTGG + Intergenic
1019375691 7:690875-690897 TGCATCCTCCTCAGCGGGCCTGG + Intronic
1019435283 7:1019452-1019474 GCCAGCCTCCTCACGGTGCCAGG - Intronic
1020432135 7:8125352-8125374 TGAAGACCCTTCACTGTGCCAGG + Intronic
1024235366 7:47393624-47393646 TGCAGCCTCCTCCCAGTGCCTGG - Intronic
1024773244 7:52750464-52750486 TGAAGCATGCTCACCCTGCCAGG + Intergenic
1029113776 7:98226461-98226483 TGGAGCCACCTCCCTGTGCCTGG + Intronic
1031429854 7:121654108-121654130 TGAATGCACCTCACCATGCCAGG + Intergenic
1032035067 7:128515479-128515501 TGCAGCCTCCTCCCCATGACAGG - Intergenic
1033304242 7:140212786-140212808 TGAAGCCTCCTCCCTGCTCCAGG + Intergenic
1035740833 8:1927257-1927279 TGAAGCTTCATCACCTGGCCTGG + Intronic
1036304849 8:7592796-7592818 TGAAGCCACCACACCATTCCTGG - Intergenic
1036355700 8:8040788-8040810 TGAAGCCACCACACCATTCCTGG - Intergenic
1047768896 8:128014543-128014565 TGAAGCCGCCTGGCCGTGTCTGG + Intergenic
1047965883 8:130046338-130046360 TGAAAACTCCTCACCTTCCCCGG - Intergenic
1048199029 8:132356138-132356160 TGGAGCCTCCACTCAGTGCCTGG - Intronic
1048867286 8:138770299-138770321 TGTAGACTCCTCTCTGTGCCTGG + Intronic
1049560736 8:143308793-143308815 TGAAGCCTCCACCCCGAGCATGG - Intronic
1052820809 9:33136833-33136855 TGAAGCCTGCTCACTGGCCCTGG - Intronic
1053264655 9:36702084-36702106 TGAAACATCCTCAGCGTGGCAGG + Intergenic
1054930251 9:70628276-70628298 TGCTTCCTCCTCACCCTGCCAGG - Intronic
1059337860 9:113580445-113580467 TTGAGTCTCCTCACAGTGCCTGG - Intronic
1060855710 9:126914174-126914196 TGTGCCCACCTCACCGTGCCTGG + Intergenic
1060896913 9:127224508-127224530 CGAAGCCCCCACTCCGTGCCCGG - Intronic
1061662648 9:132140446-132140468 GGAAGCCTCCTTGCTGTGCCTGG + Intergenic
1192615983 X:72623095-72623117 TGAAGCCTCCTTACCATGACTGG + Exonic
1200208219 X:154332883-154332905 CGAGGCCTCCTCGCCCTGCCAGG + Intergenic