ID: 1121714388

View in Genome Browser
Species Human (GRCh38)
Location 14:96062611-96062633
Sequence AGCAGCCGTGAGCAGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 413}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121714388 Original CRISPR AGCAGCCGTGAGCAGGGAGC TGG (reversed) Intronic
900131057 1:1087459-1087481 TGGAGCTGTGAGAAGGGAGCCGG + Intronic
900427386 1:2586824-2586846 AGGAGCCGGGAGCGGGGAACAGG + Exonic
900519378 1:3098300-3098322 AGGAGCAGGGAGCAGGGAGCCGG - Intronic
901103278 1:6735901-6735923 AGCAGGAGAGAGCAGGGAACAGG - Intergenic
901404797 1:9038840-9038862 AGCTGCAGTGAGCACGCAGCAGG + Exonic
901414005 1:9104648-9104670 AGGAGCTGTGAGCATGGGGCTGG + Intronic
902215494 1:14932045-14932067 GGCAGCCTGGAGCCGGGAGCAGG - Intronic
902532286 1:17098143-17098165 AACAGCAGAGAGCAGGCAGCCGG - Intronic
902542096 1:17162874-17162896 AGTCCCCGTCAGCAGGGAGCAGG - Intergenic
903178213 1:21592976-21592998 AGCAGCTCTGGGCAGGGATCCGG - Intergenic
903224131 1:21885304-21885326 GGCTGCAGTGAGCAGGGAGCTGG - Exonic
904840737 1:33370344-33370366 AGAAGCTGGGAGCTGGGAGCTGG - Intronic
905770891 1:40637161-40637183 AACAGTGGGGAGCAGGGAGCTGG + Intronic
907609999 1:55859659-55859681 TGCAGATGTGAGCAGGGAACAGG + Intergenic
908550870 1:65207435-65207457 AGCTGCCATGAGCAGGAAGTGGG + Intronic
911901012 1:103504211-103504233 AGCAGCAGTGAACAGAGGGCTGG + Intergenic
912709943 1:111943041-111943063 AGCAGAGGTGAGCTGCGAGCAGG + Intronic
915288081 1:154865510-154865532 ATCAGCCTGGAGCAGGGAGGTGG - Intronic
916683767 1:167126658-167126680 AGAAGCAGGGAGCAGGGTGCGGG + Exonic
918001594 1:180502417-180502439 AGTAGAAGTGGGCAGGGAGCAGG - Exonic
919924912 1:202187205-202187227 AGCAGACTAGAACAGGGAGCTGG + Intergenic
919980960 1:202642849-202642871 AGAAGCCGTGGGAAGGGCGCGGG - Intronic
920341026 1:205275278-205275300 AGCAGCACTGAGCAGGCAGGTGG + Intergenic
920458100 1:206116423-206116445 AGCAGCGATGAGCAGGTAGGTGG + Exonic
920859510 1:209694006-209694028 AACAACGGTGAGCTGGGAGCAGG - Intronic
922996146 1:229963168-229963190 AGCACCTGAGAGCAGGGTGCTGG + Intergenic
924335247 1:242981020-242981042 AGCAGCCCTGAGCAGGATGCAGG - Intergenic
1063016221 10:2080392-2080414 AACAGCCGAGATCAGGTAGCTGG - Intergenic
1063349824 10:5343811-5343833 AGAAGCAGTGAGCAGTGGGCAGG + Intergenic
1064156882 10:12909766-12909788 AGCACCAGTGGGGAGGGAGCAGG - Intronic
1065816420 10:29487207-29487229 AGCAGCAGTGGGGAGAGAGCAGG + Exonic
1065871978 10:29963517-29963539 AGCAGCCATTGGCAGGCAGCAGG + Intergenic
1065956443 10:30697446-30697468 AGCAGCAGTGGGGAGAGAGCAGG - Intergenic
1066037587 10:31508791-31508813 AGCAGCCATAGGGAGGGAGCTGG + Intronic
1066243732 10:33562108-33562130 AGCTGCCAGGAGCAGGCAGCGGG + Intergenic
1067363154 10:45600744-45600766 AGGAGGCGTGAGCAGGAACCGGG + Intergenic
1067775811 10:49164183-49164205 AGCAGCTTTGGGCAGTGAGCTGG - Intronic
1069583011 10:69577922-69577944 GGCGGCCCTGAGCAGGGAGGGGG - Intergenic
1069876739 10:71567752-71567774 AGCAGCTGGGAGCAAGGAGAGGG - Intronic
1069898631 10:71694614-71694636 AGCAGCTCAGAGCAGGAAGCAGG + Intronic
1071876735 10:89850923-89850945 AGCAGCAGACAGCATGGAGCAGG + Intergenic
1071974345 10:90940005-90940027 AGCAGAGGTGGGCGGGGAGCAGG + Intergenic
1072802609 10:98403566-98403588 GGCAGGCGTGAGCAGAGGGCAGG - Intronic
1073266722 10:102231981-102232003 TGCAGCCGTGCTCTGGGAGCTGG + Exonic
1073596316 10:104803907-104803929 AACAGCCTTTAGTAGGGAGCTGG - Intronic
1074447222 10:113530504-113530526 AGCAGCCAGGAGCAGGGATGTGG + Intergenic
1075336447 10:121612387-121612409 ACCAGGCTTGAGCAGGTAGCAGG - Intergenic
1075675556 10:124293498-124293520 GGATGCCCTGAGCAGGGAGCCGG - Intergenic
1075831995 10:125419571-125419593 TGCAGCAGTGAGCTGGGTGCTGG + Intergenic
1076194876 10:128510693-128510715 GTCAGGCGTGAGCAGGGAGAAGG + Intergenic
1076317703 10:129554187-129554209 TGCAGCCGTGAGCAGCACGCAGG + Intronic
1076381842 10:130028745-130028767 AGCAGCCCTGACCCAGGAGCTGG - Intergenic
1076642711 10:131929660-131929682 AGCTGCTGTGAGAATGGAGCGGG - Intronic
1076840816 10:133044272-133044294 AGAAGCTGGGAGCTGGGAGCGGG - Intergenic
1076984321 11:224048-224070 AGCAGGCCTGTGCAGGGAGGAGG - Intronic
1077211842 11:1374848-1374870 ATCAGCCGTGAGCAAGGAGGAGG - Intergenic
1077280840 11:1744728-1744750 AGCACACGTGAGCAGGGCGGAGG - Intronic
1077325344 11:1961457-1961479 GGCAGAAGGGAGCAGGGAGCTGG - Intronic
1077351736 11:2096256-2096278 AGAAGCCGTGAGGATAGAGCTGG + Intergenic
1077434987 11:2534619-2534641 TGCAGCCCTGAGGAGGGAGTGGG - Intronic
1077673576 11:4179207-4179229 AGCAGCAGTAGGCAGGGAGCTGG + Intergenic
1077673583 11:4179255-4179277 GGCAGCAGTAGGCAGGGAGCTGG + Intergenic
1077673590 11:4179303-4179325 GGCAGCAGTAGGCAGGGAGCTGG + Intergenic
1077673597 11:4179351-4179373 GGCAGCAGTAGGCAGGGAGCTGG + Intergenic
1079091282 11:17482051-17482073 TGTGGCCCTGAGCAGGGAGCGGG - Intergenic
1080047682 11:27826654-27826676 AGCAGCTGTGTGCCGGGAGATGG - Intergenic
1081715746 11:45248878-45248900 AGCAGCAGTGCCCAGGGAGCAGG - Intronic
1083424456 11:62575898-62575920 CGTAGCAGAGAGCAGGGAGCTGG + Exonic
1084662885 11:70557561-70557583 TAAAGCCGGGAGCAGGGAGCAGG + Intronic
1085045370 11:73349688-73349710 AGCAGTGGAGAGCTGGGAGCAGG + Intronic
1085249692 11:75134870-75134892 GGGAGCCCTGAACAGGGAGCAGG - Intronic
1085711308 11:78831338-78831360 AGGAGCTGGGAGCTGGGAGCTGG - Intronic
1088116873 11:106322292-106322314 AGCAGTGGTTAGCAGGGATCAGG + Intergenic
1088706032 11:112465527-112465549 AGCAGCTGAGAACAGGGAGGTGG + Intergenic
1088893056 11:114059572-114059594 GGCAGCTGTGGGCAGGGAGCCGG + Exonic
1089326981 11:117664051-117664073 AGCAGCCGGGAGGAGGGGCCGGG + Intronic
1089528856 11:119113706-119113728 AGCAGCCGTGAGTGGGGAATGGG + Exonic
1089615335 11:119691840-119691862 GACAGCCGGGAGCTGGGAGCAGG - Intronic
1089696776 11:120220814-120220836 AGTTGCTGTGAGCAGGGACCTGG + Intronic
1090552691 11:127840495-127840517 TGCAGCAGGGAGCAGTGAGCAGG + Intergenic
1090743800 11:129691346-129691368 GGCAGCCCTGAGCAGGAGGCTGG - Intergenic
1091168372 11:133500262-133500284 AGCATCTGTGAGCAGGAACCAGG + Intronic
1202808325 11_KI270721v1_random:16636-16658 GGCAGAAGGGAGCAGGGAGCTGG - Intergenic
1091400460 12:177790-177812 TGCTGCCGTGGGGAGGGAGCAGG - Exonic
1091677199 12:2500130-2500152 AGCAGGCGAGGGCAGGAAGCAGG - Intronic
1092911392 12:13148098-13148120 AAAAGCAGTAAGCAGGGAGCTGG - Intergenic
1093000637 12:13992289-13992311 AGCAGCTGTAAGCAAGGAGAGGG + Intergenic
1095240036 12:39847348-39847370 AGCAGTCGGGAGGAGGGAGGTGG - Intronic
1097070914 12:56354327-56354349 AGCTGCAGTCAGCAGGGAGCAGG + Intronic
1098948257 12:76611598-76611620 AGCAGACTGGAGCAGGGAACAGG + Intergenic
1101592882 12:106139126-106139148 GGCCGCCGTGAGCTGGGAGGGGG + Exonic
1101911324 12:108862125-108862147 AGAAGCCCTGAGCATGGAGGAGG + Intronic
1102002592 12:109566630-109566652 AGCTGCAGAGTGCAGGGAGCAGG - Intronic
1102225379 12:111224700-111224722 AGCAGGGGAGGGCAGGGAGCAGG + Intronic
1102464422 12:113120186-113120208 AGCAGGGGTGGGAAGGGAGCAGG - Intronic
1102962544 12:117101979-117102001 ACCACCAGTCAGCAGGGAGCTGG + Intergenic
1103945369 12:124523202-124523224 AGCAGCTGTGAGCTGGCAGCTGG + Intronic
1104578722 12:129993008-129993030 AGCAGCCTTTTGAAGGGAGCAGG + Intergenic
1104709814 12:130977597-130977619 AGCAGCCTTGAGAACAGAGCTGG - Intronic
1104750482 12:131235223-131235245 AGCAGCCCTGAGCCTGGAGATGG - Intergenic
1104768714 12:131346666-131346688 AGCTGCCCCGTGCAGGGAGCAGG + Intergenic
1104782238 12:131429239-131429261 AGCAGCCCTGAGCCTGGAGATGG + Intergenic
1105014182 12:132776184-132776206 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014213 12:132776343-132776365 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014230 12:132776420-132776442 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014264 12:132776578-132776600 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105780586 13:23702341-23702363 ACCAGGCCTGAGCAGGGTGCGGG - Intergenic
1106142126 13:27020265-27020287 AGCAGTCGGGGGCAGAGAGCAGG + Intergenic
1106241957 13:27920092-27920114 GGGAGCCGGGAGCCGGGAGCCGG - Exonic
1106449261 13:29864886-29864908 ACCAGGCGAGAGCACGGAGCTGG + Intergenic
1106683472 13:32031739-32031761 AGCGGCCGGGAGCAGGTACCGGG - Exonic
1106987505 13:35372627-35372649 AGCACCCATAAGCAGGGAGCTGG + Intronic
1107699946 13:43037061-43037083 AGCTGCCGGGAGCTGGGAACAGG - Intronic
1108063182 13:46553102-46553124 AGCAGCCGGGGGGAGGGCGCAGG + Intergenic
1110166195 13:72446417-72446439 AGCAGCAGAGAGTAGGGATCAGG + Intergenic
1111131339 13:83980404-83980426 AGCAGCCAAAAGCAGAGAGCCGG + Intergenic
1113470169 13:110538722-110538744 AACAGCCGTCCCCAGGGAGCTGG - Intronic
1114673543 14:24427439-24427461 ATCAGCATTGAGCAGGAAGCTGG + Exonic
1115068797 14:29296807-29296829 AGCAGCTGGTAGTAGGGAGCTGG - Intergenic
1115320645 14:32076756-32076778 AGCAGAGGGGAGGAGGGAGCGGG + Intronic
1118130580 14:62958501-62958523 AGCAGCCATGATCAGATAGCAGG - Intronic
1118323089 14:64764737-64764759 AGCAGGCGGGGGCAGGGTGCAGG + Intronic
1118744356 14:68763115-68763137 AGCAGCCGGGAGGTGGGAGCTGG + Intergenic
1118879933 14:69817374-69817396 AGCAGCAGAGAGGAGGGACCTGG + Intergenic
1121049305 14:90809844-90809866 AACAGCCCTGAGCTGGGAGATGG + Intronic
1121627750 14:95399104-95399126 AGCAGCCGAGAGCACAGAACAGG + Intergenic
1121714388 14:96062611-96062633 AGCAGCCGTGAGCAGGGAGCTGG - Intronic
1122114270 14:99520080-99520102 GGCAGCAGTGGGCAGGGAGGGGG + Intronic
1122403381 14:101480905-101480927 GGGAGCAGGGAGCAGGGAGCTGG + Intergenic
1122621031 14:103057682-103057704 GCCCGCCGGGAGCAGGGAGCCGG - Intergenic
1124203981 15:27701847-27701869 AGCAGCTTTGGGCAGGCAGCTGG + Intergenic
1124269495 15:28267818-28267840 TGGAGCCCTGAGCAGGGAGAGGG - Intronic
1124496656 15:30191595-30191617 AGAAGCCGTGGGAAGGGCGCGGG - Intergenic
1124746920 15:32347053-32347075 AGAAGCCGTGGGAAGGGCGCGGG + Intergenic
1125021743 15:34992980-34993002 GGCAGCTGGGAGCAGGGAGAGGG + Intergenic
1125519165 15:40338732-40338754 AGCAGAGGTGAGCAGGGTGGTGG - Exonic
1125599415 15:40907154-40907176 AGCAGCTGGGAGCAGGAGGCAGG + Intergenic
1125752236 15:42036770-42036792 AGCTGGCGGGAGCCGGGAGCCGG + Intronic
1126173010 15:45709690-45709712 AGCAGCAGGCAGCAGGCAGCAGG + Intergenic
1126823650 15:52528891-52528913 CGCAGCCGCCGGCAGGGAGCAGG + Exonic
1126823828 15:52529557-52529579 AGCAGCAGTGACCCGGGAGATGG + Intergenic
1127507322 15:59609947-59609969 GGCAGCTGTGAGCAGGCAGCTGG + Intronic
1127912923 15:63433188-63433210 GGCAGCAGTGAGATGGGAGCTGG - Intergenic
1128264311 15:66253706-66253728 AGCAGCCGGGAGCCGGGCGGCGG + Exonic
1128459366 15:67854709-67854731 AGTACCTCTGAGCAGGGAGCAGG + Intergenic
1128978462 15:72169608-72169630 AGCACAGGTGAGCAGGGAGGAGG + Intronic
1129388973 15:75211069-75211091 AGCAGCTGTGGGCAGGGTGAGGG - Exonic
1129683517 15:77671641-77671663 AGCAGCGGTGGGCAGGAAGGCGG + Intronic
1129689786 15:77706611-77706633 AGGAGCTGTGTGCAAGGAGCAGG - Intronic
1130112428 15:80976919-80976941 AGCAGGTGTGAGCCGTGAGCTGG - Exonic
1130325081 15:82873223-82873245 ATCAGCCTTCACCAGGGAGCTGG - Intronic
1130652481 15:85769918-85769940 AGCAGAGGTGAGCAGAGAGTGGG - Intronic
1131061110 15:89405190-89405212 TGCTGCAGTGAGGAGGGAGCTGG + Intergenic
1132505763 16:307889-307911 AGCAGCAGTGAGCAGGCCCCGGG + Intronic
1132573379 16:653728-653750 AGAAGCTGTGAACAGGGAGGAGG - Exonic
1132724124 16:1331497-1331519 GGCAGGGGTGAGCAGGGTGCTGG + Intergenic
1132727978 16:1346984-1347006 AGCAGCCCTGAGGCGGGGGCCGG - Intronic
1132800182 16:1748174-1748196 GGCAGCCGTGAGCAGGGCAGAGG + Intronic
1132988700 16:2781870-2781892 AGCAGGCGTGCTCAGAGAGCAGG - Intergenic
1133969806 16:10559371-10559393 AGCCACAGTGAGCATGGAGCTGG - Intronic
1134007974 16:10831029-10831051 AAAAGCTATGAGCAGGGAGCAGG - Intergenic
1136136279 16:28258695-28258717 AGCTGGGGAGAGCAGGGAGCCGG + Intergenic
1136288892 16:29259982-29260004 AGCAGCCAGGAGCTGGGAGGTGG + Intergenic
1136540599 16:30925764-30925786 AGCAGCCGGGGGCCGGGGGCCGG + Exonic
1136542453 16:30935715-30935737 AGCCCCCGGGAACAGGGAGCTGG - Intronic
1137716906 16:50603707-50603729 AGCAGCCTTGGGGAGCGAGCTGG - Intronic
1138337939 16:56267582-56267604 AACAGCAGTGACCACGGAGCAGG - Intronic
1138532023 16:57639723-57639745 AGAAGCGGGGAGCAGGGAGAGGG - Intronic
1139645252 16:68324709-68324731 GGCTGCCGTGAGCAGGGTGAAGG + Exonic
1139955528 16:70691340-70691362 TGCAGCCGGAAGCAGGGAGGAGG - Intronic
1140452733 16:75084078-75084100 TGCTGCAGTGACCAGGGAGCAGG - Intronic
1141336262 16:83158281-83158303 AGCAGGGGTGGGGAGGGAGCAGG - Intronic
1141698978 16:85633809-85633831 AGCAGCAGCAGGCAGGGAGCAGG - Intronic
1142026396 16:87816402-87816424 TGCAGCTTTGAGCAGGAAGCCGG - Intergenic
1142033015 16:87847739-87847761 CACAGCCGTGAGCAGTGGGCAGG - Intronic
1142094620 16:88232889-88232911 AGCAGCCAGGAGCTGGGAGGTGG + Intergenic
1142125322 16:88407307-88407329 TGCAGCTCTGAGCTGGGAGCCGG + Intergenic
1142144871 16:88488703-88488725 AGCAGAGGGGACCAGGGAGCTGG + Intronic
1142382093 16:89738704-89738726 AGCAGCTGTGAGAGAGGAGCAGG + Exonic
1143576027 17:7793744-7793766 AGCAGCCGGGAGCATGGCTCAGG - Intronic
1143896975 17:10144057-10144079 AGCAGCTTGGAGCAGGGAACGGG + Intronic
1144203817 17:12965018-12965040 AGCAGGCAAGTGCAGGGAGCAGG - Intronic
1144846821 17:18224614-18224636 ACCAGCTGTGTCCAGGGAGCAGG - Intergenic
1145943348 17:28755721-28755743 AGCAGCCCTGCCCAGGGAGAGGG + Intergenic
1146402510 17:32511028-32511050 AGCAGTTGTGAGCAGAGGGCTGG + Intronic
1146668594 17:34721412-34721434 AGCTGCTGTGAGCAGGAAACGGG + Intergenic
1147423153 17:40332407-40332429 AGCAGCCGTGAGAGGGGTGGTGG - Intronic
1147475489 17:40707870-40707892 AGCAGCCACCAGCAGGAAGCTGG - Intergenic
1147596817 17:41723141-41723163 CTCAGCCCTGAGCAGGGAACAGG - Exonic
1147636296 17:41966627-41966649 AGCAGGCGCGCGCAGGGGGCGGG + Intergenic
1147872559 17:43597872-43597894 AGCATCCGAAGGCAGGGAGCGGG + Intergenic
1147903166 17:43803826-43803848 TGCAGCTGTGAGTAGGCAGCAGG - Intronic
1149994783 17:61400660-61400682 TGGAGCCGGGAGCCGGGAGCCGG - Intronic
1150150952 17:62808375-62808397 AGCCGCCGAGAGCACGGGGCGGG + Intergenic
1150221394 17:63497535-63497557 GGCAGCCGTGTGCTGGGAGAAGG - Intronic
1150496044 17:65608487-65608509 AGCAGCCGTGATGATGCAGCAGG - Intronic
1150778328 17:68099608-68099630 GGGCGCCGTGAGCAGGGGGCAGG - Intergenic
1151397606 17:73834383-73834405 AACAGCAGTGAGGAGGCAGCCGG + Intergenic
1151727346 17:75892642-75892664 AGCGGGGCTGAGCAGGGAGCTGG - Intronic
1151780099 17:76240112-76240134 CGCAGCCGCGAGGAGGGAGAGGG - Intronic
1151838014 17:76596760-76596782 GGCTGCCATGAGCAGGGAGAGGG - Intergenic
1151915013 17:77111489-77111511 AGCAGCCGGCAGCCGGGAGGGGG + Intronic
1152214256 17:79023415-79023437 AGCAGCCTGGATCAGGGATCAGG + Intronic
1152551557 17:81032912-81032934 AGCCGCCGGGCGGAGGGAGCAGG + Intergenic
1152680785 17:81666787-81666809 AGCAGCGGTGTCCAGGGTGCAGG + Exonic
1152740379 17:82016042-82016064 AGCAGCCTGGAGCCGGGAGGGGG + Intronic
1153137198 18:1930091-1930113 AGCAGCCCTAAGCAGGCAGCTGG - Intergenic
1156391055 18:36651109-36651131 AGCAGAAGTCAGCAGGAAGCAGG - Intronic
1157006554 18:43590215-43590237 AGCAGGCAGGAGCAGGGAGCAGG - Intergenic
1157122148 18:44921377-44921399 ATGAGCCCTGAGCAGGGGGCTGG + Intronic
1157286483 18:46380644-46380666 GGGAGCTGGGAGCAGGGAGCAGG + Intronic
1157412897 18:47478663-47478685 GGCAGCCGGGTGCTGGGAGCTGG - Intergenic
1158875448 18:61730066-61730088 AGATGCTGTGAGTAGGGAGCAGG - Intergenic
1159369984 18:67516932-67516954 AGGAGCCGTGAGCAGGCCGGCGG + Exonic
1160859355 19:1231099-1231121 ACCTGCCGAGAGCAGGGGGCGGG + Exonic
1161348243 19:3778431-3778453 AGCAGGCGTGGGCAGGGGTCAGG + Intronic
1161588463 19:5118023-5118045 AGCAGCGGTGGGCAGGGGTCAGG + Intronic
1161939765 19:7395125-7395147 AGCAGCTGGGAGCCGGAAGCGGG - Intronic
1163822913 19:19506332-19506354 AGCAGCCCTGAGCAGAAAGCTGG + Exonic
1163843251 19:19624433-19624455 AGCAGCATTGACCAGGGAGTTGG + Exonic
1164775742 19:30852235-30852257 ATCATCCATCAGCAGGGAGCGGG - Intergenic
1165120591 19:33556242-33556264 GGCAGCCTTGAGCAGTGGGCGGG + Intergenic
1165413631 19:35677796-35677818 AGCAGCCCTGGGCAGGGGGATGG - Exonic
1166369640 19:42293721-42293743 AGCAGCAGTGGGCGGGCAGCCGG + Exonic
1167671306 19:50855241-50855263 AGCAGCTGGGAGCAGGGAGCTGG - Intronic
1167674053 19:50873731-50873753 AGCAGCTGGGAGCAGGGATTTGG - Intronic
1167764561 19:51472749-51472771 GGCTGCCGTGGGCTGGGAGCAGG - Intergenic
925237721 2:2293761-2293783 AGGAGCCGGGAGGAGGGAGGGGG - Intronic
925283220 2:2699286-2699308 AGGAGGCGTCAGCAGCGAGCGGG - Intergenic
925336459 2:3102333-3102355 GGCAGCTGTGAGCAGCGTGCGGG - Intergenic
925882346 2:8363335-8363357 ACCAGCCGGGAGCAGGGCTCAGG - Intergenic
929053743 2:37858627-37858649 AGCTTCAGTGAGCAGGGAGTAGG - Intergenic
932083052 2:68732667-68732689 AGCAGCAGTGGGGAGGGAGAAGG - Intronic
932469375 2:71943979-71944001 GGGAGATGTGAGCAGGGAGCAGG - Intergenic
932491689 2:72126925-72126947 AGTAGCCATGGGCCGGGAGCTGG - Intergenic
933253971 2:80059848-80059870 AGCAGCCGTAACCATTGAGCTGG + Intronic
933835499 2:86242237-86242259 TGCAGCAGTAAGCAGGGAGCTGG + Intronic
934558913 2:95302172-95302194 AGCAGCCGTGGACAGGGTGGGGG + Intronic
934609941 2:95727663-95727685 AGCAGACTTCAGCAGGCAGCAGG - Intergenic
934712049 2:96522740-96522762 AGCAGCCCTGAGCAAAGGGCAGG + Intergenic
934751561 2:96797293-96797315 GGCCGGGGTGAGCAGGGAGCAGG + Intronic
934993273 2:98936175-98936197 TGCAGCTGGGAGCTGGGAGCTGG - Exonic
935120534 2:100180056-100180078 ACCATCCGTATGCAGGGAGCTGG - Intergenic
936654187 2:114465477-114465499 AGCAGCCATTGGCTGGGAGCAGG - Intronic
936924618 2:117723593-117723615 AGCAGTGGAGAGAAGGGAGCAGG + Intergenic
937097163 2:119242870-119242892 AGCAGCCTTGAGTAGGGACCTGG + Intronic
937206269 2:120238968-120238990 TGCAGCGGGGAGCGGGGAGCGGG - Intergenic
937718685 2:125064661-125064683 AGCAGCCATCAGAAGGGAGGTGG - Intergenic
938696292 2:133838136-133838158 AGGAAGTGTGAGCAGGGAGCCGG - Intergenic
938909779 2:135875821-135875843 CGCAGCCGGGAGCATGGTGCTGG - Intronic
938948020 2:136231541-136231563 AGGAGACGTGACCAGGGAGGGGG + Intergenic
939504232 2:143026431-143026453 AGGAGCTGAGAGCAGCGAGCGGG - Intronic
940362695 2:152813300-152813322 AGCAGCCATTGGCAGGCAGCTGG + Intergenic
940859960 2:158761207-158761229 GGCAGCAGTGGCCAGGGAGCTGG + Intergenic
941588087 2:167384647-167384669 AGCAGCAGTAAGGATGGAGCAGG - Intergenic
944104815 2:196068696-196068718 CGCAGCCATGAGCAGTGAGCAGG - Exonic
948571853 2:238922656-238922678 AGCAGGCGTGGCCAGGGAGTGGG - Intergenic
948846105 2:240683495-240683517 CACAGCCAGGAGCAGGGAGCAGG - Intergenic
948916693 2:241037900-241037922 AGCAGCAGTGAGGATGGAGAGGG - Intronic
948922733 2:241073330-241073352 TGCTGCCGTGTTCAGGGAGCTGG - Exonic
949050576 2:241895475-241895497 AGCCGCCGTGAGAGAGGAGCTGG - Intronic
1169534734 20:6525746-6525768 AGCAGCCATAGGCAGGCAGCTGG + Intergenic
1169832451 20:9839128-9839150 AGGAGCCAGGAGCCGGGAGCTGG + Intergenic
1171064051 20:21995707-21995729 AGCAGCCATAGGCAGGCAGCTGG - Intergenic
1172227832 20:33317040-33317062 AGAAGCATTGAGCAGGGAGGTGG - Intergenic
1172704910 20:36876035-36876057 AGCTGGCGTGGGCATGGAGCTGG + Intergenic
1172995823 20:39069798-39069820 AGCAGCTCTAAGCAGGGAGAGGG - Intergenic
1173250102 20:41359855-41359877 AGCAGCTGTGAGCACCAAGCTGG - Exonic
1173810185 20:45950654-45950676 ACCAGCTGTCAGCAGGGATCCGG - Intronic
1174935793 20:54866860-54866882 AGCAGGAGTGAGCTGGAAGCTGG - Intergenic
1176112602 20:63417445-63417467 AGCTGCCGTGAGAAAGGAGGTGG - Intronic
1176178105 20:63738054-63738076 AGCAGGGGTGAGCAGAGGGCGGG + Exonic
1176194480 20:63831012-63831034 CGGAGCCGGGAGCCGGGAGCCGG - Intronic
1176208478 20:63904504-63904526 AGTGGCCTTGAACAGGGAGCTGG + Intronic
1178603984 21:34019132-34019154 CACAGCAGTGAGAAGGGAGCAGG - Intergenic
1179065397 21:38020020-38020042 AGCAGGTATGAGCAGGGAGCAGG - Intronic
1179221711 21:39413876-39413898 AGCAACCGAGAGCAGGAAGGAGG + Intronic
1179878618 21:44284253-44284275 GGGAGCCTTGAGCGGGGAGCAGG - Intergenic
1179932690 21:44580589-44580611 GGAAGACGTGAGCTGGGAGCTGG + Exonic
1181085824 22:20438894-20438916 AGAAGGCCTAAGCAGGGAGCGGG + Intronic
1181088557 22:20456672-20456694 AGAAGCTGAGAGCAAGGAGCAGG + Intronic
1181164682 22:20976945-20976967 AGCAGCAGGGAGAAGGGAGAAGG - Intronic
1181363378 22:22355622-22355644 CGCATCCGTGGGCAGGGAGGAGG + Intergenic
1181366263 22:22379067-22379089 CGCATCCGTGGGCAGGGAGGAGG + Intergenic
1181960365 22:26618111-26618133 AGCAGGCCTGGGCAGGGAGTGGG + Intergenic
1182019759 22:27071586-27071608 AGCAGAGGAGATCAGGGAGCTGG + Intergenic
1182023844 22:27101942-27101964 AGCAGTGATGAGCAGGGAGTGGG + Intergenic
1182353359 22:29711068-29711090 AGGAGCCTTGAGCAGGGGGTGGG - Intergenic
1182687071 22:32129405-32129427 AGCAGACGTGAGCAGGTCCCTGG + Intergenic
1182861556 22:33563875-33563897 AGAAGCCCTGAGAAGGAAGCAGG + Intronic
1183284514 22:36953599-36953621 TGCAGCAGTGAGGAGGGGGCAGG + Intergenic
1183362019 22:37387747-37387769 AGAGGCAGTGAGCAGGGACCAGG - Intronic
1184303319 22:43576975-43576997 AGCAGCTGGGAGGAGGGATCAGG + Intronic
1184389086 22:44192687-44192709 AGCCCCAGTGGGCAGGGAGCAGG - Intronic
1184389107 22:44192747-44192769 AGCCCCAGTGGGCAGGGAGCAGG - Intronic
1184414012 22:44341745-44341767 AACAGCAATGAGCATGGAGCAGG - Intergenic
1184450256 22:44578305-44578327 AGGAGCATTGAACAGGGAGCTGG + Intergenic
1184652496 22:45925602-45925624 AGCAGAGATGAACAGGGAGCTGG - Intronic
1185219908 22:49624038-49624060 AGCAGCCCCGAGCAGGGCCCTGG - Intronic
1185330796 22:50251302-50251324 AGCGACCGGGAGCAGGGCGCGGG - Exonic
949920491 3:8996452-8996474 GGCAGCCTTCTGCAGGGAGCAGG + Intronic
950270969 3:11614546-11614568 AGCTGCAGTGGGCAGGTAGCTGG + Intronic
950357845 3:12426531-12426553 AGCAGCGGGGGGCAGGGAGGGGG + Intronic
950479115 3:13233811-13233833 ACCACATGTGAGCAGGGAGCCGG - Intergenic
950669893 3:14519670-14519692 CCCAGCTATGAGCAGGGAGCTGG - Intronic
950959374 3:17089018-17089040 GGCAGCCGTGGGCACGCAGCAGG - Intronic
951544954 3:23815476-23815498 AGCATCTGTGTGCAAGGAGCAGG - Intronic
951999906 3:28773155-28773177 ATCACCCTTGAACAGGGAGCAGG - Intergenic
952382490 3:32816434-32816456 AGCGGCCGGGAGAAGGGAGGAGG + Intergenic
952884685 3:38005274-38005296 AGAAGCAGTGAGGGGGGAGCAGG - Intronic
953129895 3:40127834-40127856 AGCATCCTGGAGCTGGGAGCTGG - Intronic
953667938 3:44939534-44939556 AGGAGCCAGGAGCAGGGAGGTGG - Intronic
953888764 3:46735073-46735095 AGCAGGGGTGAGAAGAGAGCAGG + Intronic
954695197 3:52420735-52420757 AGCAGCCGTGAGAAGGCATGTGG + Intronic
954971674 3:54656565-54656587 AGCAGCACTGAGAAGAGAGCAGG + Intronic
957244791 3:77702995-77703017 AGCACCGGTGAGCTGGGTGCAGG - Intergenic
959085780 3:101849565-101849587 GGCAGCCGCGCGCAGCGAGCCGG + Exonic
959546193 3:107599294-107599316 AGCAGCAGAGAGCAGGGATGGGG - Intronic
961332754 3:126152658-126152680 AGCAGCCGGGGGTAGGGAGAGGG - Intronic
961449302 3:126995285-126995307 AGGAGCTGGGAGCAGGGCGCAGG - Intronic
961497515 3:127305120-127305142 AGCAGCCAGGAACAGGGAGCAGG - Intergenic
961522153 3:127473121-127473143 AGCAGAGTTGAGCAGAGAGCAGG + Intergenic
962382431 3:134908716-134908738 AGAAGGCGTGAGGAGGGAGAAGG + Intronic
964620254 3:158714139-158714161 AACAGGAGTGTGCAGGGAGCTGG + Intronic
964752085 3:160062155-160062177 AGTAGCCGGGAGTAGGGACCAGG + Intergenic
965195259 3:165586929-165586951 AGGATGCATGAGCAGGGAGCAGG - Intergenic
965813377 3:172614118-172614140 TGCAGCTGTCAGCAGGGAGAAGG + Intergenic
966774054 3:183528576-183528598 TCCAGCCGTGGGGAGGGAGCAGG - Intronic
967836365 3:193966829-193966851 AGCAGCAATGAGCAGGGCACTGG + Intergenic
967845216 3:194037529-194037551 AGAAGCCGTCAGATGGGAGCAGG + Intergenic
968393742 4:213860-213882 GGCAGCCGGCAGCAGGGTGCGGG - Intergenic
968451674 4:678885-678907 AGGAACCGGGAGCAGGGGGCGGG + Intronic
968534071 4:1112944-1112966 AGAAGCGGTGGGGAGGGAGCGGG - Intronic
968750733 4:2387565-2387587 AGGAGGCCTGGGCAGGGAGCAGG + Intronic
968876441 4:3270233-3270255 GGGAGCCGTGCCCAGGGAGCCGG + Intronic
969361208 4:6664810-6664832 AGCCGCTGGGCGCAGGGAGCGGG - Intergenic
969525052 4:7700078-7700100 GGCAGCTGTGTCCAGGGAGCAGG - Intronic
969576077 4:8036485-8036507 AGCAGCCGTGAAGAGGGTGCTGG + Intronic
969715606 4:8866826-8866848 AGGAGCCGGGAGTAGGGAGGAGG - Intronic
971097432 4:23423751-23423773 GGCAGCTTTGAGCAGGGAGTGGG - Intergenic
972393515 4:38635548-38635570 AGCTGCCTTGAGCAGCGTGCTGG + Intergenic
974619788 4:64340532-64340554 AGCAGCAGGCAGCAGGGGGCTGG - Intronic
979241866 4:118454260-118454282 AGCAGCCCTGAGCAGGATGCAGG + Intergenic
981089925 4:140721881-140721903 AGCAGATGTGAGCAGGTAGAAGG - Intronic
981093479 4:140756344-140756366 CGCCGCCGTGGGCCGGGAGCCGG - Intergenic
981692573 4:147526076-147526098 AGAAGACATGAGCAGGGAACTGG + Intronic
985626860 5:993524-993546 AGCAGCCGTGAGCAGCTGGATGG + Intergenic
985669833 5:1201575-1201597 AGTGGCCGTGGGCCGGGAGCCGG - Exonic
985704853 5:1394401-1394423 CAGAGCCGGGAGCAGGGAGCAGG + Exonic
985985825 5:3515412-3515434 AGCAGGCCTGAGTAGGGAGTGGG - Intergenic
992550139 5:77851987-77852009 GGGAGCCGGGAGCCGGGAGCCGG - Intronic
992812970 5:80408040-80408062 AGAAGCCCTGAGCCGGGATCTGG + Exonic
993116095 5:83722019-83722041 AGCAGCCGGGAGGAGGGAGCGGG + Intergenic
996666275 5:126064028-126064050 AGCAGCCAGGAGCATGCAGCAGG + Intergenic
998952335 5:147404749-147404771 AGCAGAAGTCAACAGGGAGCAGG + Intronic
1002418867 5:179135125-179135147 TGGAGCCGGGAGCTGGGAGCTGG - Intronic
1004265934 6:14148567-14148589 ATGAGCCCTGAGCAGGGAGGTGG - Intergenic
1004782064 6:18920355-18920377 AGCAGGTGTGAGTTGGGAGCAGG - Intergenic
1005842894 6:29755805-29755827 AGTAGCTGGGAGAAGGGAGCCGG - Intergenic
1005987692 6:30884595-30884617 AGGAGCCGGGAGCCGGGAGCGGG - Intronic
1006136081 6:31897256-31897278 TGCAGCCGGGAGGAGGGGGCGGG - Intronic
1006815253 6:36845563-36845585 AAGAGAAGTGAGCAGGGAGCTGG - Intergenic
1007521375 6:42453308-42453330 AGCAGCTGCGAGCAGGGGGCAGG + Intergenic
1007616977 6:43186027-43186049 AGCAGTCCAGAGCTGGGAGCTGG + Exonic
1009616233 6:66010522-66010544 AGCAGCCCAGAGCAGGGAAGTGG + Intergenic
1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG + Exonic
1013623210 6:111910278-111910300 AGCACCCCTAAGGAGGGAGCAGG + Intergenic
1015768560 6:136745453-136745475 AGCAGCCAGAGGCAGGGAGCTGG - Intronic
1016558630 6:145369096-145369118 AGCAGCAGTGAGCAATGAGGTGG + Intergenic
1017146699 6:151240992-151241014 AGCCGCCGTGGGCAGGGCGCGGG - Intronic
1018349659 6:162943464-162943486 AGCAGCCATACGCAGGCAGCTGG - Intronic
1019343345 7:518612-518634 AGCAGCGGGGTGCGGGGAGCGGG - Intronic
1019421668 7:953876-953898 AGCAGCCAGGTGCAGGGAGCCGG + Intronic
1019666054 7:2252794-2252816 GGCAGGGGTGAGGAGGGAGCAGG - Exonic
1019666130 7:2253037-2253059 GGCAGGGGTGAGGAGGGAGCAGG - Exonic
1020076338 7:5261427-5261449 AGCAGAAGTGATCTGGGAGCAGG + Intergenic
1022785364 7:33632487-33632509 AGCAGCCGCGAGCGGGGCGAGGG - Intergenic
1023870987 7:44262979-44263001 AGCAGCCTGGGGTAGGGAGCGGG - Intronic
1024015631 7:45311850-45311872 AGCAGCTATGGGCAGGTAGCTGG + Intergenic
1024786350 7:52911664-52911686 AGCTGGCGTGAGCTGGGAACAGG - Intergenic
1025202752 7:56972146-56972168 AGCAGAAGTGATCTGGGAGCAGG - Intergenic
1025669192 7:63604780-63604802 AGCAGAAGTGATCTGGGAGCAGG + Intergenic
1026045673 7:66904076-66904098 CGCAGCCACGAGCAAGGAGCTGG - Intergenic
1026208532 7:68280498-68280520 AGCAGCCATAGGCAGGCAGCTGG - Intergenic
1026808490 7:73443057-73443079 AGCAGCAAAGAGCAGGCAGCGGG + Intronic
1027224482 7:76235293-76235315 AGCAGGGGTGAGCAGGCCGCGGG + Exonic
1028626233 7:92880716-92880738 AGCAGCCATAGGCAGGTAGCAGG - Intergenic
1029193178 7:98786136-98786158 AGCATCCGTGTGCAGGGAGCAGG - Intergenic
1029519600 7:101051756-101051778 AACAGCCGTGATCAGAGGGCTGG - Intronic
1029592258 7:101514910-101514932 CCCAGCTGTGAGCAGAGAGCAGG + Intronic
1032750248 7:134832384-134832406 GTCAGTCATGAGCAGGGAGCAGG - Intronic
1033672952 7:143510983-143511005 CGCCGCCCTGAGCAGGGTGCTGG - Intergenic
1033880005 7:145869290-145869312 AGCTGCTGTGTGCAGGTAGCTGG + Intergenic
1035235818 7:157497111-157497133 AGCACCCGTGAGCGGGGAGGAGG - Intergenic
1035393824 7:158522897-158522919 ACCTGCCGTGAGAAGGGAGAGGG + Intronic
1035725596 8:1823571-1823593 CGCAGCTCTGAGCCGGGAGCAGG + Intergenic
1035852641 8:2936260-2936282 AGCATCGTTGACCAGGGAGCAGG + Intronic
1037772819 8:21812373-21812395 GGCAGCAGAGAGCAGGGTGCGGG - Intergenic
1039048503 8:33472276-33472298 TGCAGCAGGGAGCAGGGGGCAGG + Intronic
1039419174 8:37421280-37421302 GGCAGCAGGGAGCAGGGTGCTGG - Intergenic
1039605642 8:38878067-38878089 AGGAGCCAGGAGCAGGGAGGAGG + Intergenic
1040444495 8:47479636-47479658 AGCAGCCATGAGCAGGGGCTGGG + Intronic
1041593901 8:59623840-59623862 AGCAGCCTGGAGCAGGGTACAGG + Intergenic
1042936217 8:74061105-74061127 AGGAGCCTAGAGAAGGGAGCAGG - Intergenic
1043760647 8:84063520-84063542 TGCAGCCATGAGCTGTGAGCTGG + Intergenic
1044072376 8:87778383-87778405 AGCAGCCGTAAGTAGGTGGCTGG - Intergenic
1044632531 8:94293182-94293204 GACAGCAGGGAGCAGGGAGCAGG + Intergenic
1045587873 8:103559489-103559511 GGCTGCTGTGAGAAGGGAGCAGG + Intronic
1046946483 8:119978948-119978970 GGGAGCAGGGAGCAGGGAGCAGG - Intronic
1046946487 8:119978962-119978984 AGTGGGGGTGAGCAGGGAGCAGG - Intronic
1048203854 8:132400075-132400097 GGCAGACCTGAGCAGTGAGCTGG + Intronic
1048856271 8:138689128-138689150 AGCAGTCATGGGCAGGGAGGAGG - Intronic
1049204020 8:141355029-141355051 AGCACCCGAGAGCTGGGGGCTGG + Intergenic
1049575349 8:143387232-143387254 AGCTGCCGAGAGGAGTGAGCTGG - Intergenic
1049582953 8:143421041-143421063 AGCAGCCGTGAAATGGGGGCAGG - Intronic
1049657371 8:143804763-143804785 GGCAGCGGTCAGCAGGGAGACGG + Exonic
1051857444 9:21585039-21585061 ATCAGCCCAGAGCATGGAGCTGG - Intergenic
1053414722 9:37939935-37939957 AGCAGCCCAGAGCAGGTGGCGGG + Intronic
1056097156 9:83266939-83266961 ACCAGCAGTGAGCAGGAAGCTGG + Intronic
1056114719 9:83430824-83430846 ATCACCCCTGTGCAGGGAGCTGG + Intronic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1059417259 9:114169557-114169579 AGCAGCTTAGAGCAGGGAGCTGG + Intronic
1060436880 9:123600939-123600961 AGGAGCAGTGGGCAGTGAGCAGG - Intronic
1060522701 9:124302735-124302757 GGCAGCCCAGAGCAGAGAGCAGG - Intronic
1061178039 9:129009123-129009145 GGCAGCCGACAGCAGTGAGCTGG - Exonic
1061202578 9:129146218-129146240 AGAATGCGGGAGCAGGGAGCGGG - Intronic
1061577914 9:131519096-131519118 AGCAGCTGAGTGCAGGGTGCAGG - Intronic
1061678655 9:132231876-132231898 GGCAGCCCTGGGCAGAGAGCAGG + Intronic
1061818271 9:133208771-133208793 GGGAGCCCTGAGCAGGGGGCTGG - Intronic
1062242181 9:135546587-135546609 GGGAGCCCTGAGCAGGGGGCTGG + Intronic
1186105514 X:6201705-6201727 AGATGCCATGAGCAGGGAGCAGG + Intronic
1186336413 X:8594129-8594151 AGCAGCTGTGAACAGAGAGCAGG + Intronic
1186766332 X:12774005-12774027 TGTTGCCGTGAGCAGGAAGCAGG - Intergenic
1188141732 X:26558867-26558889 AGCAGCCCTTAGCAGGCTGCGGG - Intergenic
1188299936 X:28495865-28495887 AGCAGGACTGAGCAGGGACCTGG - Intergenic
1189160791 X:38805881-38805903 AGCAGCCCGGAGCTGGGTGCTGG + Exonic
1189300172 X:39946852-39946874 TGCAGGCTTGAGCAGGGAGTAGG + Intergenic
1190382533 X:49853741-49853763 AGGAGCCGTGGTCACGGAGCTGG - Intergenic
1193560017 X:83007289-83007311 TGCAGCCCTGAGCAGGCAGATGG - Intergenic
1195346458 X:103954821-103954843 AGCTGTGGGGAGCAGGGAGCAGG - Intronic
1195360990 X:104084015-104084037 AGCTGTGGGGAGCAGGGAGCAGG + Intergenic
1195360992 X:104084022-104084044 GGGAGCAGGGAGCAGGGAGCAGG + Intergenic
1197694888 X:129540284-129540306 GGGAGCCGGGAGCGGGGAGCTGG - Exonic
1199768526 X:150958397-150958419 AGCAGCCTTGAGCAGCCAGCTGG + Intergenic
1199979705 X:152914225-152914247 AGCAGCCCTGGGCAGGCAGGTGG + Intergenic
1200153954 X:153965444-153965466 AGCAGCCTTCAGCTGGGACCAGG + Intronic
1200830411 Y:7683738-7683760 AGAAGACGTGAGCAGGCAGAAGG + Intergenic
1201426971 Y:13862157-13862179 AGCAGCTGTGAACAGAGAGCAGG - Intergenic
1201491734 Y:14549128-14549150 AGATGCTATGAGCAGGGAGCCGG - Intronic
1202389575 Y:24356085-24356107 AGCAGCCCTGAGCAGGATGCAGG + Intergenic
1202481209 Y:25314029-25314051 AGCAGCCCTGAGCAGGATGCAGG - Intergenic