ID: 1121714820

View in Genome Browser
Species Human (GRCh38)
Location 14:96066052-96066074
Sequence CACGTGGCTGTGGCTTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 261}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121714820_1121714826 2 Left 1121714820 14:96066052-96066074 CCTCAGGAAGCCACAGCCACGTG 0: 1
1: 0
2: 2
3: 30
4: 261
Right 1121714826 14:96066077-96066099 GGAGCTCCTCAGGTACAGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 182
1121714820_1121714834 24 Left 1121714820 14:96066052-96066074 CCTCAGGAAGCCACAGCCACGTG 0: 1
1: 0
2: 2
3: 30
4: 261
Right 1121714834 14:96066099-96066121 GGAGGTGGGGCATCTCAAACAGG 0: 1
1: 0
2: 3
3: 15
4: 177
1121714820_1121714831 10 Left 1121714820 14:96066052-96066074 CCTCAGGAAGCCACAGCCACGTG 0: 1
1: 0
2: 2
3: 30
4: 261
Right 1121714831 14:96066085-96066107 TCAGGTACAGCCAGGGAGGTGGG 0: 1
1: 0
2: 3
3: 35
4: 268
1121714820_1121714830 9 Left 1121714820 14:96066052-96066074 CCTCAGGAAGCCACAGCCACGTG 0: 1
1: 0
2: 2
3: 30
4: 261
Right 1121714830 14:96066084-96066106 CTCAGGTACAGCCAGGGAGGTGG 0: 1
1: 0
2: 4
3: 27
4: 352
1121714820_1121714835 30 Left 1121714820 14:96066052-96066074 CCTCAGGAAGCCACAGCCACGTG 0: 1
1: 0
2: 2
3: 30
4: 261
Right 1121714835 14:96066105-96066127 GGGGCATCTCAAACAGGCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 126
1121714820_1121714824 -8 Left 1121714820 14:96066052-96066074 CCTCAGGAAGCCACAGCCACGTG 0: 1
1: 0
2: 2
3: 30
4: 261
Right 1121714824 14:96066067-96066089 GCCACGTGGAGGAGCTCCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 128
1121714820_1121714828 6 Left 1121714820 14:96066052-96066074 CCTCAGGAAGCCACAGCCACGTG 0: 1
1: 0
2: 2
3: 30
4: 261
Right 1121714828 14:96066081-96066103 CTCCTCAGGTACAGCCAGGGAGG 0: 1
1: 0
2: 1
3: 98
4: 363
1121714820_1121714827 3 Left 1121714820 14:96066052-96066074 CCTCAGGAAGCCACAGCCACGTG 0: 1
1: 0
2: 2
3: 30
4: 261
Right 1121714827 14:96066078-96066100 GAGCTCCTCAGGTACAGCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 198
1121714820_1121714832 11 Left 1121714820 14:96066052-96066074 CCTCAGGAAGCCACAGCCACGTG 0: 1
1: 0
2: 2
3: 30
4: 261
Right 1121714832 14:96066086-96066108 CAGGTACAGCCAGGGAGGTGGGG 0: 1
1: 0
2: 6
3: 40
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121714820 Original CRISPR CACGTGGCTGTGGCTTCCTG AGG (reversed) Intronic
900075352 1:811648-811670 TACATGGCTGTGGCTCCCTGGGG + Intergenic
900409138 1:2504978-2505000 CACGCGGCTGTGGCTGCGGGAGG - Exonic
900456691 1:2778369-2778391 CCCGGGGCTGTGGCTGCCTCAGG + Intronic
900532927 1:3163514-3163536 CACGCGGCGTTAGCTTCCTGGGG + Intronic
901318382 1:8324113-8324135 CACTGGGCTTTGGCCTCCTGGGG + Intronic
901889624 1:12251547-12251569 CAAATGGCTGTGGCTGCTTGGGG + Intronic
902957576 1:19936264-19936286 CACCAGCCAGTGGCTTCCTGGGG + Intergenic
903382566 1:22907187-22907209 CAACTGATTGTGGCTTCCTGGGG - Intronic
904836634 1:33341958-33341980 CAGCAGGCTGTGGCTCCCTGAGG + Intronic
905368228 1:37467579-37467601 CACCTGACTGTGGCTCCTTGAGG - Intergenic
906567963 1:46814013-46814035 CACATGGCCGCCGCTTCCTGCGG + Exonic
907073707 1:51560225-51560247 CAGGTGGCTGTGGCTTCCAGAGG + Intergenic
911182558 1:94874278-94874300 CATATGGCTGTGGCTTAGTGTGG + Intronic
911357346 1:96838609-96838631 CAGGTGTCTGTGGCTTCAGGGGG - Intergenic
918384872 1:183995551-183995573 GACGTGGCTCTGGCTTCCGGAGG - Intronic
922211803 1:223492055-223492077 AAAGTGACAGTGGCTTCCTGTGG + Intergenic
922271193 1:224036525-224036547 TACATGGCTGTGGCTCCCTGGGG + Intergenic
922617712 1:226972961-226972983 GACCTGGCTGTGGCTTGCTGTGG + Intronic
923259743 1:232257674-232257696 GGAGTGGCCGTGGCTTCCTGAGG - Intergenic
923269945 1:232346590-232346612 TAGGTGACTGTGGCTCCCTGTGG + Intergenic
923810100 1:237305305-237305327 CATGTGGATGTGGACTCCTGTGG - Intronic
924181781 1:241446174-241446196 CAAGTGGCTGTGGCTCCCCAAGG - Intergenic
1062840625 10:667323-667345 GACCTGGCTGAGGCCTCCTGGGG + Intronic
1062971073 10:1649910-1649932 CATGAGGGAGTGGCTTCCTGAGG + Intronic
1062981223 10:1724622-1724644 CACCAGGCTGTGGCTCACTGAGG - Intronic
1063179322 10:3583754-3583776 CAGGTGGCTGTGGCTTTGTGGGG - Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1070727945 10:78804783-78804805 CACGTGGGGCTGGCTTCCTAAGG - Intergenic
1070932828 10:80273111-80273133 CACGTGGCTGTGGGACCCTGTGG + Exonic
1071003651 10:80858903-80858925 CATGTGTCTCTGTCTTCCTGTGG - Intergenic
1071419709 10:85479974-85479996 CAGGTAGCTGAGGCTTGCTGGGG + Intergenic
1072220493 10:93323677-93323699 CACGTGCGTGTGCCTGCCTGTGG - Intronic
1075733634 10:124651180-124651202 CACCTGGCTCTGTCTCCCTGTGG - Intronic
1076239915 10:128897004-128897026 CACTTGGCTGGGTCTGCCTGTGG + Intergenic
1076311493 10:129510994-129511016 CACGTGTCTGTGTCTGGCTGCGG - Intronic
1077038716 11:507773-507795 CACGGGGCCGTGGCTCCCTCGGG - Intergenic
1077186011 11:1235693-1235715 CCCTGGGCTGTGGCTGCCTGTGG + Intronic
1077273490 11:1692703-1692725 TGGGTGTCTGTGGCTTCCTGGGG - Intergenic
1077307072 11:1873211-1873233 CCCTTGGCTGTGCCTCCCTGGGG + Intronic
1077307916 11:1876165-1876187 TCCGTGGCTGAGGCTTCCAGAGG - Intronic
1077422816 11:2460927-2460949 CATGGGGGTGTGGCCTCCTGTGG + Intronic
1080402376 11:31947808-31947830 CCTATGGATGTGGCTTCCTGTGG - Intronic
1081654152 11:44846358-44846380 AACGTGGCTGTACCTTCTTGCGG + Intronic
1081957579 11:47106935-47106957 CACATGGCTGTGCCTTCTTATGG + Intronic
1082026054 11:47573112-47573134 CACCCGGCTTTGCCTTCCTGAGG - Exonic
1084486407 11:69450700-69450722 ATCCTGGCTGTTGCTTCCTGCGG + Intergenic
1085351602 11:75801392-75801414 CACTTTTCTGTGCCTTCCTGAGG + Exonic
1086570969 11:88283945-88283967 CACGTGGCTGGGGAGGCCTGGGG - Intergenic
1088318108 11:108527810-108527832 AACGTGGCTGTGGCTGCCTCTGG + Intronic
1088592630 11:111416448-111416470 CAGGGGACTTTGGCTTCCTGAGG + Intronic
1089284257 11:117395541-117395563 TGGGTGGCTGTGGCTTCCTAGGG - Exonic
1089729137 11:120509826-120509848 GTCTTGGCTGTGGCCTCCTGAGG - Intergenic
1090250015 11:125244573-125244595 CACTTTGCTGAGGCTGCCTGGGG - Intronic
1090380817 11:126326375-126326397 CACGGGGCTGTGGGTCCTTGGGG + Intronic
1091003125 11:131927549-131927571 CAAGTGCATGTGGCTTCCAGAGG - Intronic
1091675717 12:2487987-2488009 CACATGTCTGAGACTTCCTGAGG - Intronic
1091703236 12:2677659-2677681 CCCGAGGCTGTGGCTGGCTGGGG + Intronic
1097401260 12:59130915-59130937 CACGTGTGTGTGCATTCCTGAGG + Intergenic
1100855062 12:98750831-98750853 CCCGCAGCTGAGGCTTCCTGCGG - Intronic
1101812771 12:108121817-108121839 CATGTGGCTGTGGCTCCAGGTGG + Intergenic
1103870196 12:124085754-124085776 AACCTGGCTGGTGCTTCCTGGGG + Intronic
1104241030 12:126989880-126989902 GAGGTGGCAGTGGCTTCCTCTGG - Intergenic
1104674250 12:130702002-130702024 CATGTGGATGTTGCTCCCTGTGG + Intronic
1105894729 13:24708284-24708306 CATGTGGCTGTGGCTTACGTGGG + Intronic
1107865719 13:44701352-44701374 CAGGTGGCTGGTCCTTCCTGAGG + Intergenic
1109258502 13:60113848-60113870 CAAATGGCTGGGGCTTCATGTGG - Intronic
1110751415 13:79119923-79119945 CAGGTGGGTGTGGGTTCGTGGGG - Intergenic
1112502152 13:99951227-99951249 CACTTGGCTGTGGCTTTCCGAGG - Intergenic
1113852859 13:113427918-113427940 CACGTGCCTGTGCCTTGCAGGGG + Intronic
1115350567 14:32390570-32390592 CCTATGGATGTGGCTTCCTGAGG + Intronic
1116973724 14:51094395-51094417 CACATGACGGTGGCTTCCTTGGG + Exonic
1118740836 14:68738159-68738181 CAGATGGATGTGACTTCCTGGGG - Intergenic
1121011368 14:90522152-90522174 CCCGTGGCTGTGGCCTCCAGTGG + Intergenic
1121409586 14:93740355-93740377 GACTTGGCTGTGTCTTCCTGGGG + Intronic
1121714820 14:96066052-96066074 CACGTGGCTGTGGCTTCCTGAGG - Intronic
1122043674 14:99008380-99008402 CACGTGGCTGTGGCTGCAGCTGG - Intergenic
1122165691 14:99821986-99822008 CACGTGGCTGTGGAAGACTGTGG + Intronic
1122402447 14:101475454-101475476 CCCGTCGCTGTGGCCACCTGGGG + Intergenic
1122796000 14:104206538-104206560 CCTGTGGCTGAGGCTGCCTGGGG - Intergenic
1122800125 14:104225221-104225243 AAGGTGGGTGTGGCTCCCTGGGG + Intergenic
1122800167 14:104225396-104225418 AAGGTGGGTGTGGCTCCCTGGGG + Intergenic
1122877953 14:104677473-104677495 CAGGAGGCTGTGGCTGGCTGAGG + Intergenic
1124232106 15:27954731-27954753 CCGATGGCTGTGACTTCCTGGGG - Intronic
1126809181 15:52383438-52383460 CAGGTTTCTGTAGCTTCCTGTGG - Intronic
1128271205 15:66311508-66311530 CACGGTGGAGTGGCTTCCTGGGG + Intronic
1128863394 15:71093434-71093456 CACATGATTGTGGCTTCCCGAGG + Intergenic
1131170609 15:90175388-90175410 CTGGAGGCTGTGGCTCCCTGGGG + Intronic
1131229836 15:90651754-90651776 CACGTGTCTGTAGATTTCTGGGG - Intergenic
1134233211 16:12445438-12445460 CAGGAGGCTGGGGCTCCCTGAGG + Intronic
1134928319 16:18184840-18184862 CACGTGTCTGTGACCTCCGGCGG - Intergenic
1136533645 16:30886572-30886594 TACGAGGCTGTGGGCTCCTGAGG - Intronic
1137568448 16:49549170-49549192 CACTGGGCTTTGGATTCCTGGGG + Intronic
1139251580 16:65501548-65501570 TACCTTGCTGTGTCTTCCTGGGG + Intergenic
1143751641 17:9032446-9032468 CTGGTGCCTGAGGCTTCCTGGGG + Intronic
1145090299 17:19980324-19980346 CAAGTGGCTGTGTCTACCAGGGG + Intergenic
1146006319 17:29162934-29162956 CAAGGGGCTGTGTCTCCCTGGGG + Intronic
1146433287 17:32819465-32819487 CACATGGCTCTGACTTGCTGTGG + Intronic
1146692593 17:34886948-34886970 CACGTGGCTCTTGCTACCCGGGG - Intergenic
1147154925 17:38539640-38539662 CAGGAGGCTGTGACTCCCTGGGG - Intronic
1148070521 17:44906101-44906123 CGTGTGGCAGTGGCTTACTGGGG + Intronic
1148438989 17:47702159-47702181 CAAGTGACTGAGGCTTCCTTGGG - Intronic
1149989562 17:61374531-61374553 CCCGTGACTGTTCCTTCCTGCGG + Intronic
1150008139 17:61482408-61482430 CAAGTGGCTTTGGCTCCCTGAGG + Intronic
1150062980 17:62084754-62084776 CACGTGGGTGTGGCTCCCTTTGG - Intergenic
1150138439 17:62708909-62708931 TCCCTGGCTGGGGCTTCCTGGGG - Intronic
1150295214 17:64003769-64003791 AATGTGGCTGTGGCCTCCTGCGG + Exonic
1151548388 17:74807169-74807191 CACGTGCCTGTGCCTTGCTTTGG + Intronic
1151963319 17:77418880-77418902 CTCCTGGCTGTGGCTTCCAGGGG - Intronic
1155044086 18:22088609-22088631 TGCGTGGCAGTGGCTTCCTACGG - Intronic
1155744152 18:29330511-29330533 CACATAGCTGTAGCTTCCTAGGG - Intergenic
1157682739 18:49619588-49619610 CAGGGGGTGGTGGCTTCCTGGGG + Intergenic
1157751252 18:50180253-50180275 CACTGGGCTGTGGCTTCCCAAGG + Intronic
1157967770 18:52227645-52227667 CAGGTGGCTCTGGCTTCTTCTGG + Intergenic
1159721529 18:71897823-71897845 CACGTGGCTGTGGAGGCCTCTGG - Intergenic
1161313858 19:3608885-3608907 CCCGTGGCTGCGGTTTCCGGCGG + Intergenic
1161698346 19:5782551-5782573 GCAGTGGCTGTGGCTTCCTGGGG + Intergenic
1162761655 19:12892052-12892074 CTTGGGGCTGGGGCTTCCTGTGG + Intronic
1163006175 19:14397916-14397938 CACCTGGCTGTGGACTCCAGGGG - Exonic
1163061569 19:14765521-14765543 CACCTGGCTGTGGACTCCAGGGG + Exonic
1163312538 19:16522805-16522827 CACATGGCTGAAGCTCCCTGTGG + Intronic
1163689731 19:18731968-18731990 CACCTGGGTTTGGCTGCCTGTGG + Intronic
1165706502 19:37979995-37980017 CACCGGCCTGTGGATTCCTGAGG - Intronic
1166390635 19:42407146-42407168 CAGGTGGCTGTGGGGGCCTGAGG + Intronic
1166738134 19:45098093-45098115 CACCTGGCTGTGGCTTGCTGAGG - Intronic
1167116100 19:47489854-47489876 CCTGGGGCTGGGGCTTCCTGAGG + Intronic
1168146740 19:54423780-54423802 CACGTGGCTGCGTCCTCCGGGGG + Intronic
1168154057 19:54463477-54463499 TCCGTGGCGGGGGCTTCCTGCGG + Exonic
1168179396 19:54650537-54650559 GGAGTGGCAGTGGCTTCCTGGGG + Intronic
1168316496 19:55486837-55486859 CCCGTGGCTGTGGCCGCCTGGGG + Exonic
1168681395 19:58318492-58318514 TAGATGGCTGTGGCTGCCTGTGG - Intergenic
925118446 2:1399208-1399230 CACGTGGCTCTGCCTCCCTCGGG - Intronic
925122660 2:1431326-1431348 ACCATGACTGTGGCTTCCTGAGG + Intronic
925390235 2:3489407-3489429 CACTGGACTGTGGCGTCCTGAGG + Intergenic
925431782 2:3801059-3801081 AAGGTGGTTGTGGATTCCTGGGG - Intronic
925488432 2:4363785-4363807 AAGGTGGCTTTGGCTACCTGAGG + Intergenic
926869111 2:17392480-17392502 CACATGGCTGGGGATGCCTGAGG - Intergenic
929504925 2:42521004-42521026 CACATCTCTGGGGCTTCCTGTGG + Intronic
931585666 2:63824265-63824287 CACGTGGCTGGGGAGTCCTCAGG - Intronic
933840484 2:86282396-86282418 CTCGTGGCTGGGGCATCCTTGGG + Intronic
935636872 2:105255827-105255849 CCCGTGGTTGTGGCTTCCATGGG - Intergenic
936951871 2:117985747-117985769 CACCTGGCTCTGCCTTCCTTTGG - Intronic
937334830 2:121055713-121055735 TACCTGGCCGTGGCTTCCTGGGG + Intergenic
938205660 2:129420345-129420367 AAATTGCCTGTGGCTTCCTGCGG - Intergenic
938502076 2:131835602-131835624 CAGGTGGGGCTGGCTTCCTGGGG - Intergenic
940174485 2:150863561-150863583 CATGGGGATGGGGCTTCCTGAGG - Intergenic
941186649 2:162327155-162327177 CACCTGGCTTTGGATTCCTTAGG + Intronic
941384871 2:164841153-164841175 TACCTGGCTGGGGCGTCCTGCGG + Exonic
942214707 2:173707242-173707264 CACGCGGCTGTCTCTTTCTGAGG - Intergenic
943864196 2:192907880-192907902 CATGTGGTTGTGACTACCTGTGG + Intergenic
943882538 2:193164340-193164362 CACGTGGCTGTGGAGACCTCGGG - Intergenic
944153219 2:196584211-196584233 CAGGTGGGAGTTGCTTCCTGTGG + Intronic
946145268 2:217725839-217725861 CACGTGGATTTGGCTGTCTGGGG - Intronic
947665734 2:231904351-231904373 AAAGTGGCTGTGGCCTCCTGTGG + Intergenic
947854049 2:233311336-233311358 GAAGAGGCTGTGGTTTCCTGGGG + Intronic
948790620 2:240374722-240374744 GACGTGGCTGTGGTATTCTGAGG - Intergenic
948796188 2:240403038-240403060 CACGGGGCTGTGGAATCGTGTGG + Intergenic
948806221 2:240454379-240454401 CCGGTGGCTGTGGCATCCTCCGG - Intronic
949082370 2:242113147-242113169 TACATGGCTGTGGCTCCCTGGGG - Intergenic
1169853399 20:10077731-10077753 CACATGACTGTGGCTTCCTAAGG + Intergenic
1170627105 20:18038238-18038260 CAGTTGGCAGAGGCTTCCTGAGG - Intronic
1170701230 20:18705504-18705526 AACCTGGCGGTAGCTTCCTGGGG - Intronic
1171085247 20:22232636-22232658 GGCGGGGCTGTGGCATCCTGGGG - Intergenic
1172515145 20:35528184-35528206 GATGTGGCTGTGGGTTGCTGTGG - Intronic
1175811684 20:61861814-61861836 CAGGTGGCTGTGTTGTCCTGTGG + Intronic
1177578895 21:22994183-22994205 CCCGTGGGTGGGGCTTGCTGTGG - Intergenic
1177816716 21:25986111-25986133 CACGTGTCTCTGGCCTTCTGTGG - Intronic
1179063911 21:38006009-38006031 CAGGTGGGTGTGGCTGTCTGAGG + Intronic
1179711873 21:43268196-43268218 TATGTGGCTCTGGCTTCCTCAGG - Intergenic
1180096310 21:45556831-45556853 CCTGTGGCCGGGGCTTCCTGGGG + Intergenic
1180105784 21:45617242-45617264 GACGTGGCTTTGTCCTCCTGTGG + Intergenic
1180257588 21:46643147-46643169 CCCCTGGCTGTGCCTGCCTGGGG + Intronic
1180750191 22:18119170-18119192 CATGTGGCTGTGACTTCCCAGGG - Intronic
1181377844 22:22474708-22474730 CACCTTGCTGTGGTTTCCTGGGG - Intergenic
1181495027 22:23282877-23282899 CACGAGGTTGTGGACTCCTGAGG + Intronic
1183789574 22:40055168-40055190 CACCTGGCTGTGCATTCCTTGGG - Intronic
1184308437 22:43625197-43625219 ACAGTGGCTGTGGCTTCCAGGGG + Intronic
1184478732 22:44735405-44735427 CACATGAATGTGGCCTCCTGGGG - Intronic
1184897314 22:47418027-47418049 CATGAGGGTGTGGCTGCCTGAGG + Intergenic
1185017430 22:48352877-48352899 CACCTCGCTGTGGCTCTCTGAGG - Intergenic
1185389156 22:50549493-50549515 CACGAGGCTGTGGCCTGCCGTGG + Exonic
950134127 3:10568632-10568654 CAGGAGGCCGTGGTTTCCTGAGG - Intronic
951183871 3:19689224-19689246 CCTATGGATGTGGCTTCCTGAGG - Intergenic
953717840 3:45331099-45331121 CTAGTAGCTGTGGCTCCCTGGGG - Intergenic
954380742 3:50217731-50217753 CACGTGGCTGAAGTTGCCTGTGG - Exonic
956815947 3:72908422-72908444 CACCTGGCTGTGGTGGCCTGTGG + Exonic
959722222 3:109505093-109505115 CCTATGGATGTGGCTTCCTGTGG + Intergenic
961358505 3:126353425-126353447 CATGTTGCTGAGGCTTCCAGAGG + Intronic
961779524 3:129313571-129313593 CACATGGCTGTGGCTGTTTGGGG - Intergenic
962481977 3:135805916-135805938 CACATAGCTCTGGCTGCCTGGGG - Intergenic
963062272 3:141234525-141234547 CCAGTGGGTGTTGCTTCCTGTGG + Intronic
963593009 3:147286618-147286640 GATGTGGCTGTGGCTTCAGGGGG - Intergenic
964100911 3:152987437-152987459 CACTTGGCAGTGGTTTCCTGGGG + Intergenic
967734220 3:192935241-192935263 GATGTGCCTGAGGCTTCCTGAGG + Intergenic
968125587 3:196157624-196157646 CCTATGGATGTGGCTTCCTGAGG + Intergenic
968601334 4:1511417-1511439 CAAGTGGCTGTGGTCTCCGGAGG - Intergenic
968873377 4:3252716-3252738 CCAGTGGCTGTCGCTCCCTGAGG + Intronic
968992982 4:3927159-3927181 CACGTCGCTGTGACCTCGTGAGG - Intergenic
969055687 4:4401299-4401321 AAAGTGGCAGTTGCTTCCTGGGG + Intronic
970420151 4:15898431-15898453 TAGTTGGCAGTGGCTTCCTGAGG - Intergenic
972048820 4:34702616-34702638 CACTTGGGTGGGTCTTCCTGCGG - Intergenic
974653124 4:64781166-64781188 CCGGTGGCTATGGCTTCATGTGG - Intergenic
977678609 4:99774340-99774362 CACCAGGCTGGGGCTCCCTGTGG + Intergenic
978343339 4:107739981-107740003 TTTGTGGCTGTGGCTCCCTGTGG + Intergenic
979880366 4:125949270-125949292 CCCGTGGCTGTGTCTTCTGGAGG - Intergenic
981387284 4:144146464-144146486 CCCAGGGATGTGGCTTCCTGAGG - Intergenic
983819354 4:172173388-172173410 CATGAGGCTGTGGATTCCTCTGG + Intronic
984605837 4:181785352-181785374 AAAGTAGCTGTGGCTTTCTGGGG - Intergenic
985691173 5:1313495-1313517 CACGTGGCTGTGCCTGCCTTTGG - Intergenic
985694224 5:1330964-1330986 CAGGTGGCCCTGGCTGCCTGGGG - Intronic
985824430 5:2181932-2181954 GACCAGGCTGTGGCTTCCAGAGG + Intergenic
986039892 5:3983237-3983259 CACGTGGCAGTGGCCAGCTGGGG + Intergenic
986095573 5:4550515-4550537 CACATTGCTGTGTCCTCCTGGGG - Intergenic
986253358 5:6081426-6081448 CAGATGGCATTGGCTTCCTGGGG - Intergenic
986569680 5:9152196-9152218 CACAGGCCTGCGGCTTCCTGTGG + Intronic
986965522 5:13266739-13266761 CACGTGGCTGAGGCGGCCTTAGG + Intergenic
987053007 5:14164139-14164161 CACGTGAATGTGTCATCCTGAGG - Intronic
987673107 5:21039468-21039490 CATGTGTCTGAGGTTTCCTGTGG - Intergenic
987677560 5:21094151-21094173 CACATGGCTGTGGATGCCTCAGG - Intergenic
987696736 5:21342141-21342163 CACGTTGCTGTTGCTGGCTGTGG - Intergenic
988779111 5:34503056-34503078 CACGGGGCTGTGACTGGCTGAGG - Intergenic
988993048 5:36690155-36690177 TGCGGGGCTGTGGCTGCCTGCGG + Intergenic
990488342 5:56280441-56280463 CCCATGGCTGTGGATCCCTGCGG + Intergenic
994193030 5:96889685-96889707 CAAGATGCTGTGGCTCCCTGTGG + Intronic
995069721 5:107905855-107905877 CAGGAGGCTGTAGCTGCCTGAGG - Intronic
996091793 5:119358651-119358673 CCAGTGGATGGGGCTTCCTGAGG + Intronic
997758636 5:136423645-136423667 CACTTGCGGGTGGCTTCCTGAGG + Intergenic
998737130 5:145155073-145155095 CATGTGGCTGGGTCTTCCTGAGG - Intergenic
1001699880 5:173699140-173699162 CCCCTGGCTGTGGCTGCCTGTGG + Intergenic
1001932671 5:175684290-175684312 TACCTGTCTGTGGCTCCCTGGGG - Exonic
1002819448 6:711117-711139 CAGGTGGCTGACGCTTCCCGTGG - Intergenic
1005760346 6:28961693-28961715 CCTATGGATGTGGCTTCCTGAGG - Intergenic
1006425213 6:33959244-33959266 CCGGGGGCGGTGGCTTCCTGGGG + Intergenic
1007290033 6:40778574-40778596 CACAAGGCTGTGGCCTGCTGGGG - Intergenic
1007495805 6:42259696-42259718 CACTCGGCTGATGCTTCCTGGGG + Exonic
1007616775 6:43184502-43184524 CATGTGGCTGTCGGCTCCTGAGG + Exonic
1007726923 6:43922164-43922186 CACATGGCAGGGTCTTCCTGGGG + Intergenic
1011168702 6:84479901-84479923 CCTATGGATGTGGCTTCCTGTGG - Intergenic
1016279793 6:142403185-142403207 CATGTGGCTGTGGCTGTCAGTGG - Intronic
1018043490 6:159945629-159945651 CATGTGGGTGAGGCTGCCTGAGG + Intergenic
1018981118 6:168602613-168602635 CACGTGGCTGTGGGTGCCAAGGG - Intronic
1019059699 6:169248207-169248229 CACATGCCTGTGGCTGCGTGTGG + Intronic
1019186480 6:170223475-170223497 CAATTGGGTGGGGCTTCCTGTGG + Intergenic
1019620667 7:1990378-1990400 GGAGTGGCTGTGGCTTCCTAAGG + Intronic
1020426529 7:8072437-8072459 CAGGTGTCTTTGGCTTCATGTGG + Intronic
1020920473 7:14257680-14257702 CACGTGGCTGTGGAGGCCTCAGG - Intronic
1023847512 7:44130896-44130918 CACAGGGCTGTGGCTTTCAGGGG + Intergenic
1024243555 7:47453311-47453333 TGAGTGGCTGTGCCTTCCTGGGG + Intronic
1024632621 7:51262195-51262217 CTCGAGGATGTGGCCTCCTGGGG - Intronic
1026737333 7:72957407-72957429 CCTGTGGCTGTGGTGTCCTGTGG - Intergenic
1026787535 7:73311405-73311427 CCTGTGGCTGTGGTGTCCTGTGG - Intergenic
1026863211 7:73807319-73807341 CTTCTGGCTGAGGCTTCCTGGGG - Intronic
1027106399 7:75407661-75407683 CCTGTGGCTGTGGTGTCCTGTGG + Intronic
1027263943 7:76483613-76483635 CACGTGGCAGTGGCTGCAGGTGG + Intronic
1027315313 7:76981724-76981746 CACGTGGCAGTGGCTGCAGGTGG + Intergenic
1029364061 7:100106191-100106213 CAAGGGACTGTGCCTTCCTGGGG + Intronic
1031704082 7:124960465-124960487 GAAGTGGCTGTGACTACCTGAGG + Intergenic
1033132447 7:138756361-138756383 CACATGACTGTGGCTTCTAGAGG - Intronic
1034657878 7:152743768-152743790 CACGTTGCTGTGACCTCCGGAGG + Intergenic
1034963634 7:155377993-155378015 CGCGGGGCTGGGGCTTCCGGGGG - Intergenic
1035540291 8:429873-429895 TAGATGGCTGTGGCTCCCTGGGG - Intronic
1035676924 8:1462585-1462607 CACGGGACTGTGGCTACCTTGGG + Intergenic
1035717461 8:1764515-1764537 CACGTGGGTGTGGCCTCCACTGG + Intronic
1035775203 8:2182431-2182453 AAAGTGGCTGTGGCTCTCTGGGG + Intergenic
1035890021 8:3333056-3333078 CACGTGGCTGTGGTCTTCTCTGG - Intronic
1036463317 8:8973562-8973584 CACGAGGCTGTGGCTTGCGCTGG - Intergenic
1037625808 8:20605804-20605826 CACTTGGCTCTGGCTGCCAGCGG - Intergenic
1037677960 8:21068191-21068213 TACATGGCTGGGGGTTCCTGAGG - Intergenic
1038748387 8:30273940-30273962 CACATGGCTGGGGCTGCCTCAGG - Intergenic
1039123659 8:34176104-34176126 CCTGTGGATGTGGCCTCCTGTGG - Intergenic
1040568956 8:48591550-48591572 CTCCTGGCTGTGGTTTCCTGAGG + Intergenic
1041724347 8:61004438-61004460 CACATGGCTCTGGCTTTCTGGGG - Intergenic
1045809475 8:106204768-106204790 CATGTGGAAGTGGCTCCCTGTGG - Intergenic
1046353385 8:113046249-113046271 CCCGTGGCTGTTGTTCCCTGTGG - Intronic
1046967147 8:120180566-120180588 CTCCTGGCTGTGCCTTCCTCTGG + Intronic
1049317376 8:141976528-141976550 CACATGGCTCTGCCCTCCTGGGG - Intergenic
1049440383 8:142606990-142607012 CCCGTGACTGTGGATTCCTACGG + Intergenic
1050619721 9:7440216-7440238 CACTTGCCTATGGCTTCCAGGGG + Intergenic
1051616306 9:19010250-19010272 CACGTGGCACTGGTTGCCTGAGG - Intronic
1053162329 9:35821839-35821861 AAGGTGGCTGTGGATTCCAGTGG + Intronic
1056020815 9:82436711-82436733 CGCCTGGCTGTGGATTACTGGGG + Intergenic
1056526262 9:87445778-87445800 AACGAGGCTGTGGCTGCCTGAGG - Intergenic
1056576963 9:87862799-87862821 CGCCTGGCTGTGGATTACTGGGG + Intergenic
1057810857 9:98255670-98255692 CCCGACTCTGTGGCTTCCTGGGG - Intronic
1061097190 9:128465224-128465246 CACTTGCCAGTGGCTTCCTGTGG + Intronic
1185876652 X:3707358-3707380 CATGTGCCTGGGGTTTCCTGAGG - Intronic
1187753387 X:22492808-22492830 CACGTGGGAATGGCTTCCTCTGG + Intergenic
1188807960 X:34614676-34614698 CACGTGGCTGGGGATGCCTCAGG + Intergenic
1190278273 X:48913082-48913104 CATAAGACTGTGGCTTCCTGAGG + Intergenic
1192452237 X:71251719-71251741 CGAGTGCCTGTGGCTTCTTGGGG + Intronic
1196758880 X:119181844-119181866 CACGTGGTTCTGGCTGCCTGAGG - Intergenic
1198003238 X:132462590-132462612 CATGTGGCTGTGTCTTTCTTTGG - Intronic
1200224268 X:154408598-154408620 CATGTGGCTTTTGCATCCTGAGG + Intronic
1200964720 Y:9025626-9025648 CTCCCGGATGTGGCTTCCTGTGG - Intergenic
1200966404 Y:9043280-9043302 CAGGTGGCTGTTGCTGGCTGGGG - Intergenic