ID: 1121715570

View in Genome Browser
Species Human (GRCh38)
Location 14:96071571-96071593
Sequence GTGAACACACACTGCCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121715564_1121715570 11 Left 1121715564 14:96071537-96071559 CCATCATTGCTACTACTGTCACC 0: 1
1: 0
2: 3
3: 19
4: 215
Right 1121715570 14:96071571-96071593 GTGAACACACACTGCCCCCTGGG 0: 1
1: 0
2: 0
3: 19
4: 153
1121715565_1121715570 -10 Left 1121715565 14:96071558-96071580 CCCCAATTAAGCCGTGAACACAC 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1121715570 14:96071571-96071593 GTGAACACACACTGCCCCCTGGG 0: 1
1: 0
2: 0
3: 19
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121715570 Original CRISPR GTGAACACACACTGCCCCCT GGG Intronic
900316969 1:2061748-2061770 GTGAGAACACACTGCCCACTCGG + Intronic
903012032 1:20338048-20338070 CTGCACACACACTGCCCAGTTGG + Intronic
906054072 1:42900549-42900571 CTGAACACACACCGCCACCAGGG - Intergenic
906059211 1:42937437-42937459 GAGACCACACACTGCCAGCTAGG + Intronic
907118769 1:51990750-51990772 GCGAACACAGACTCCGCCCTTGG - Exonic
909931826 1:81505502-81505524 GTGAACCCTCACTGCCCTCAAGG + Intronic
912323686 1:108738280-108738302 GAGAACCCTCACTGCCTCCTTGG + Intronic
916943360 1:169699489-169699511 GTTATTACACACTGCCCCCTGGG - Intronic
917076618 1:171212793-171212815 GTTAACACATTCTGCCTCCTTGG - Intergenic
921932973 1:220770382-220770404 CTGAAGACACACTTCCTCCTTGG - Intronic
923114069 1:230917932-230917954 GTGAAGCCATTCTGCCCCCTGGG + Intronic
924814608 1:247430813-247430835 GTGATCACACACTCCAGCCTGGG - Intronic
1062794940 10:337778-337800 GTGCACACACACAGCTGCCTAGG - Intronic
1063092405 10:2878922-2878944 GGGAACACACCCTGGCCCCGTGG - Intergenic
1064296482 10:14083577-14083599 GTGAATACAGACTGACCCCAGGG - Intronic
1064565699 10:16636723-16636745 GTGCACCCACCCTGCCCCCCAGG - Intronic
1065311359 10:24418717-24418739 GGTTACAAACACTGCCCCCTAGG - Intronic
1066341389 10:34537481-34537503 GTGAACACCCATTGTCTCCTTGG - Intronic
1067251370 10:44589724-44589746 GTAAACACACAGCGCCCCCAAGG + Intergenic
1067565769 10:47335750-47335772 GTGCTCACACACTGCCCACCTGG - Intergenic
1072682319 10:97516362-97516384 TTGAACACACAGTGCCACCGTGG + Intronic
1076291075 10:129346108-129346130 GTGAGCACACACTCACCCCTGGG - Intergenic
1076779531 10:132716581-132716603 GTGGAGACACACGGCCCCCATGG - Intronic
1077532847 11:3105378-3105400 GTCCACACACACTGTCCACTGGG - Intronic
1078568110 11:12434572-12434594 CTGAACACATAGTGCCCTCTGGG + Intronic
1082903794 11:58284814-58284836 CTGAACACACACACCCCACTGGG + Intergenic
1091172738 11:133532742-133532764 GTGAACACACACGAGCTCCTTGG + Intergenic
1091585935 12:1816677-1816699 GTGCACACAGACTGTCACCTCGG + Intronic
1091998502 12:5014504-5014526 GTGCACACTCAGTGCACCCTTGG - Intergenic
1092321737 12:7483587-7483609 GTCATCACACACTGTCCCCCAGG + Exonic
1094000803 12:25692088-25692110 GTGAAAACACACTGTCCTCAGGG - Intergenic
1096469023 12:51864733-51864755 TTGAGCAGACACAGCCCCCTTGG - Intergenic
1098094073 12:66936100-66936122 ATCAGGACACACTGCCCCCTGGG - Intergenic
1098657317 12:73049074-73049096 GTGAACATACACTTCCCTGTAGG - Intergenic
1098722630 12:73922203-73922225 GTGAGCAGCCACTGCACCCTGGG - Intergenic
1099793339 12:87363778-87363800 GTGAACCCACGCTGCCACCAGGG - Intergenic
1106654614 13:31729870-31729892 GTAAAGCCAAACTGCCCCCTCGG + Intergenic
1107806178 13:44155978-44156000 GTCAACATTCACTGCCCCCTGGG - Intronic
1107864025 13:44686189-44686211 GTGAAAACTCACTGACCTCTGGG + Intergenic
1110695594 13:78484498-78484520 GTGACCACACACTGGCCCTGTGG - Intergenic
1113628762 13:111865857-111865879 GTGAACAGCCACGGCCTCCTTGG + Intergenic
1113843468 13:113373150-113373172 GTGGACATACACTGCCTCCTAGG + Intergenic
1114289928 14:21279432-21279454 GAGAACAAACACTGCACCGTTGG - Intergenic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1119219259 14:72893183-72893205 GGGAGCAGACGCTGCCCCCTCGG + Intronic
1121715570 14:96071571-96071593 GTGAACACACACTGCCCCCTGGG + Intronic
1122992231 14:105241885-105241907 GTGTGCACACACAGCCCCCGTGG - Intronic
1126827231 15:52564223-52564245 GTGAACACAACATGCTCCCTTGG - Intronic
1127352939 15:58170907-58170929 GTGATCACTTACGGCCCCCTTGG + Intronic
1129295487 15:74597807-74597829 GTGAACCCTCACTGCCCTCAAGG + Exonic
1133116709 16:3581700-3581722 GTGATGGCCCACTGCCCCCTGGG + Exonic
1134038974 16:11053444-11053466 TGCAACACACTCTGCCCCCTGGG + Intronic
1134074960 16:11284201-11284223 GCAAAAGCACACTGCCCCCTGGG + Intronic
1136114147 16:28084019-28084041 GGGAACACACTCTTCCACCTGGG - Intergenic
1136773980 16:32861368-32861390 GTGAATCCACACTGATCCCTGGG + Intergenic
1136896629 16:34000151-34000173 GTGAATCCACACTGATCCCTGGG - Intergenic
1139646445 16:68334606-68334628 ATGAACACACGCTGCTCCCTGGG - Intronic
1203076400 16_KI270728v1_random:1123479-1123501 GTGAATCCACACTGATCCCTGGG + Intergenic
1142661429 17:1432411-1432433 GTGATCTCACTCTGCCTCCTGGG - Intronic
1144827553 17:18114806-18114828 GTGCTCACTCACTGCCTCCTTGG + Intronic
1146054035 17:29572459-29572481 TTGAACAGACACAGCCCCCTGGG - Exonic
1147028259 17:37608815-37608837 GTCCACACACACACCCCCCTTGG + Intronic
1151206717 17:72513265-72513287 GTGAACACAGACATCCCTCTCGG - Intergenic
1151604712 17:75129110-75129132 GGGAGCACATACTGCCCCATTGG + Exonic
1151767686 17:76140604-76140626 CCGTACACACACTGTCCCCTCGG - Intronic
1152330871 17:79671837-79671859 GTGCACACACACAGTCTCCTGGG - Intergenic
1152878093 17:82799771-82799793 GTGAACACAGACCTCCCTCTTGG + Intronic
1155320437 18:24613531-24613553 ATGGACACACACTGCACCATAGG - Intergenic
1156540108 18:37901298-37901320 GCGAACACACACTGGCCCTAAGG - Intergenic
1159318112 18:66806978-66807000 GTGAACACAGAATGGCCACTAGG + Intergenic
1159946622 18:74448612-74448634 GTGCACACACACTTCCCTCTTGG - Intronic
1161145615 19:2676365-2676387 GTGAACATGCACAGCCCCCAAGG + Intronic
1162502400 19:11061367-11061389 GTGACCACACTCGGCCCTCTCGG - Intronic
1162753314 19:12841825-12841847 GTGAAGACAGACAGCTCCCTTGG + Intronic
1164592952 19:29516169-29516191 GTGGACACAGACTGCTCCCCCGG - Intergenic
1164824114 19:31271711-31271733 CTGAACATACATTTCCCCCTGGG - Intergenic
1166365124 19:42274314-42274336 GTGAAACCCCAGTGCCCCCTGGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925758274 2:7156325-7156347 CTGATCTCACACTGCTCCCTAGG + Intergenic
926126747 2:10276884-10276906 CTGACCACCCACCGCCCCCTCGG - Intergenic
926149664 2:10417991-10418013 ATGATCACACACTGCAGCCTGGG + Intronic
926827494 2:16921594-16921616 TTGAACACACACTACTCACTAGG - Intergenic
929625526 2:43402935-43402957 GTGAACCCAAACTGCCCCTCAGG + Intronic
932620842 2:73264222-73264244 GTGAACCCACCTTTCCCCCTGGG - Intronic
934521437 2:95022561-95022583 CTGAACGCGCACTTCCCCCTAGG - Intergenic
937260708 2:120585422-120585444 GAGAACTCACACTGCTCCCCCGG + Intergenic
944912655 2:204325578-204325600 ATATGCACACACTGCCCCCTAGG - Intergenic
948506346 2:238429508-238429530 CTGAACACACACTATCCCCAAGG - Intronic
1168829120 20:834615-834637 GGGGACACCCCCTGCCCCCTAGG + Intronic
1169401216 20:5282357-5282379 TTGAACACACACCCCCCACTGGG + Intergenic
1172014310 20:31863828-31863850 CTGAACACACACTCCCCCTGTGG - Intronic
1175306027 20:57976194-57976216 ATGAACACACACTCCACGCTTGG - Intergenic
1175630792 20:60534764-60534786 GTGACCACACACTCCTCCCTGGG - Intergenic
1175822038 20:61915248-61915270 CTGAACACACACAGACACCTTGG - Intronic
1180913967 22:19472433-19472455 GAGAGCTCACACTGCCCGCTGGG - Intronic
1181015127 22:20064215-20064237 CTGACCACACACTTCCCCTTTGG - Intronic
1181326263 22:22049598-22049620 ATTAACACACATTTCCCCCTGGG + Intergenic
1181551997 22:23644991-23645013 GTGCACACGCTCTGCCTCCTGGG - Intergenic
1182202030 22:28582956-28582978 GTGAACACACTCTTTCCTCTGGG - Intronic
1184647935 22:45906222-45906244 GTGAACATTCACTGCCCTCCTGG - Intergenic
1185077292 22:48690237-48690259 GTGTTCACACAATGACCCCTTGG + Intronic
954246070 3:49332407-49332429 GTGATCACACACTACAGCCTGGG + Intronic
963259055 3:143176058-143176080 GTGGACACACACTCCCGCTTGGG + Intergenic
963810107 3:149767987-149768009 GTGAACACCGACTGCCTCGTGGG + Exonic
965606184 3:170499704-170499726 GTGAACACGCCCTGCCTGCTTGG + Intronic
968485582 4:859445-859467 GTGCAGACACGCTGTCCCCTTGG + Intronic
974698290 4:65403002-65403024 CAGAACACAAACTGTCCCCTAGG + Intronic
976504616 4:85832372-85832394 GTGAAAACACACTGCCAGGTGGG + Intronic
979449672 4:120855488-120855510 CAGAACACTCACTGCCCACTGGG + Intronic
988281624 5:29155965-29155987 GTGAACACACTCAGCCTCCAAGG - Intergenic
989275956 5:39588781-39588803 GTGAACATGCACTCCCCCTTGGG - Intergenic
992435766 5:76754927-76754949 ATGAACACACCCTGCTCCCCTGG + Intergenic
992641760 5:78773907-78773929 ATGATCACACACTGGCCCCTCGG + Intergenic
992819755 5:80484635-80484657 GTGAATAGCCACTGCACCCTAGG - Intergenic
995067594 5:107879844-107879866 GTGGCCACAGACTGCCCCCTGGG + Intronic
997446008 5:133940928-133940950 GGGAACTCAAACTACCCCCTTGG - Intergenic
999637238 5:153635548-153635570 GTGAACACTCACTCCAGCCTTGG + Intronic
1002299103 5:178247602-178247624 GTGGCCACTCACTGGCCCCTGGG + Intronic
1003102835 6:3190378-3190400 TTGACCACACACCGCCCCCATGG - Intergenic
1006365176 6:33611039-33611061 GTGACCCCTCCCTGCCCCCTCGG + Intergenic
1006423411 6:33949351-33949373 GGGAACCAACACTGACCCCTGGG - Intergenic
1007200344 6:40102770-40102792 GTGAACACACAGGGCCTTCTAGG + Intergenic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1009817646 6:68756407-68756429 GTGCACACACAGTTCCCCCTTGG - Intronic
1013184157 6:107743398-107743420 TTGAACACACAATGACCCATGGG - Intronic
1014639240 6:123889234-123889256 GTCAAGTCACAATGCCCCCTAGG - Intronic
1015217156 6:130763299-130763321 GTGAAAACACACTGCCTTCCTGG + Intergenic
1016299754 6:142617550-142617572 ATAGACACACACTGCCCCTTGGG + Intergenic
1021628520 7:22620516-22620538 GTGAACTCTCCTTGCCCCCTTGG - Intronic
1024620785 7:51155711-51155733 TTTAACACACACTACCCCATAGG - Intronic
1025173631 7:56783896-56783918 GTTAGCACTCCCTGCCCCCTTGG - Intergenic
1029599648 7:101556169-101556191 GTGAACACTGACTGCCACTTCGG + Intronic
1033561329 7:142535195-142535217 GTGACTACACACTGGCCACTTGG + Intergenic
1037808551 8:22072265-22072287 GTAAACACACACTGACCCCATGG + Intronic
1039583574 8:38686418-38686440 TTGAACACACCCTTCCCTCTGGG + Intergenic
1042153124 8:65811364-65811386 GTGAACAAACACAGCCCTCCAGG + Intronic
1045421470 8:102020903-102020925 GTTCATACACACTGCTCCCTTGG + Intronic
1050894953 9:10874664-10874686 GTTATGACACACTGCCCCTTTGG + Intergenic
1053177805 9:35941469-35941491 GTGAAGTCACATTGCCCCCATGG - Intergenic
1053431870 9:38047401-38047423 GTGTACACACACCTCCCCTTCGG + Intronic
1056969098 9:91187728-91187750 GTGGACACACCCTGCCCACCAGG + Intergenic
1058296659 9:103316190-103316212 GTGAACACACACAGATACCTGGG + Intergenic
1058754932 9:108075434-108075456 GTGAACACCCACTGCCCACCAGG - Intergenic
1061500877 9:131001228-131001250 GTGTACAAACACTGCCCATTGGG + Intergenic
1062383378 9:136298384-136298406 TTGAACAAACTCCGCCCCCTCGG - Intronic
1185550733 X:981022-981044 GTGTCCACACTCTCCCCCCTGGG + Intergenic
1185550782 X:981177-981199 GTGTCCACACTCTCCCCCCTGGG + Intergenic
1185550847 X:981379-981401 GTGTCCACACTCTGCCCTCTGGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1187330950 X:18338886-18338908 GTCACCACACACTGTCACCTGGG - Intronic
1189911521 X:45814937-45814959 GTGAGCACTGACTGACCCCTGGG - Intergenic
1190194369 X:48304725-48304747 GTCACCCCACACTGTCCCCTGGG + Intergenic
1190200254 X:48355127-48355149 GTCACCCCACACTGTCCCCTGGG + Intronic
1190203620 X:48384154-48384176 GTCACCCCACACTGTCCCCTGGG - Intronic
1190206916 X:48411250-48411272 GTCACCCCACACTGTCCCCTGGG + Intronic
1190655843 X:52611636-52611658 GTCACCCCACACTGTCCCCTGGG + Intergenic
1190667065 X:52705627-52705649 GTCACCCCACACTGTCCCCTGGG + Intronic
1190672353 X:52752781-52752803 GTCACCCCACACTGTCCCCTGGG - Intronic
1193632961 X:83912178-83912200 GGGAAGACACAGTGCCTCCTGGG - Intergenic
1194122321 X:89976248-89976270 GCGAACAAGCACTGCCCACTAGG + Intergenic
1196792608 X:119477947-119477969 GTGACCACACAGTGGCCCCTGGG - Intergenic
1197664709 X:129211014-129211036 CTGAACACACACCCCCCACTGGG - Intergenic
1198590370 X:138173775-138173797 GTGAATAGACAAGGCCCCCTTGG + Intergenic
1200475181 Y:3633683-3633705 GCGAACAAGCACTGCCCACTAGG + Intergenic