ID: 1121718019

View in Genome Browser
Species Human (GRCh38)
Location 14:96089914-96089936
Sequence CGATCCCTCTCCCCTGTCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 254}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121718019_1121718030 29 Left 1121718019 14:96089914-96089936 CCCAGGACAGGGGAGAGGGATCG 0: 1
1: 0
2: 2
3: 16
4: 254
Right 1121718030 14:96089966-96089988 GTACTGGCTTCTCCCTGGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 173
1121718019_1121718025 13 Left 1121718019 14:96089914-96089936 CCCAGGACAGGGGAGAGGGATCG 0: 1
1: 0
2: 2
3: 16
4: 254
Right 1121718025 14:96089950-96089972 TCTAGCTGGGGCCTCTGTACTGG 0: 1
1: 0
2: 0
3: 21
4: 148
1121718019_1121718024 1 Left 1121718019 14:96089914-96089936 CCCAGGACAGGGGAGAGGGATCG 0: 1
1: 0
2: 2
3: 16
4: 254
Right 1121718024 14:96089938-96089960 CCTCATTCAGACTCTAGCTGGGG 0: 1
1: 0
2: 5
3: 10
4: 124
1121718019_1121718028 25 Left 1121718019 14:96089914-96089936 CCCAGGACAGGGGAGAGGGATCG 0: 1
1: 0
2: 2
3: 16
4: 254
Right 1121718028 14:96089962-96089984 CTCTGTACTGGCTTCTCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 285
1121718019_1121718029 28 Left 1121718019 14:96089914-96089936 CCCAGGACAGGGGAGAGGGATCG 0: 1
1: 0
2: 2
3: 16
4: 254
Right 1121718029 14:96089965-96089987 TGTACTGGCTTCTCCCTGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 203
1121718019_1121718031 30 Left 1121718019 14:96089914-96089936 CCCAGGACAGGGGAGAGGGATCG 0: 1
1: 0
2: 2
3: 16
4: 254
Right 1121718031 14:96089967-96089989 TACTGGCTTCTCCCTGGGTGGGG 0: 1
1: 0
2: 0
3: 29
4: 245
1121718019_1121718021 -1 Left 1121718019 14:96089914-96089936 CCCAGGACAGGGGAGAGGGATCG 0: 1
1: 0
2: 2
3: 16
4: 254
Right 1121718021 14:96089936-96089958 GTCCTCATTCAGACTCTAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1121718019_1121718027 24 Left 1121718019 14:96089914-96089936 CCCAGGACAGGGGAGAGGGATCG 0: 1
1: 0
2: 2
3: 16
4: 254
Right 1121718027 14:96089961-96089983 CCTCTGTACTGGCTTCTCCCTGG 0: 1
1: 0
2: 2
3: 33
4: 281
1121718019_1121718022 0 Left 1121718019 14:96089914-96089936 CCCAGGACAGGGGAGAGGGATCG 0: 1
1: 0
2: 2
3: 16
4: 254
Right 1121718022 14:96089937-96089959 TCCTCATTCAGACTCTAGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121718019 Original CRISPR CGATCCCTCTCCCCTGTCCT GGG (reversed) Exonic