ID: 1121721866

View in Genome Browser
Species Human (GRCh38)
Location 14:96115004-96115026
Sequence CAAGCTCATCCACTAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121721866_1121721873 26 Left 1121721866 14:96115004-96115026 CCCATTTCTAGTGGATGAGCTTG No data
Right 1121721873 14:96115053-96115075 CTTTTTCCCATTTATCCCCTTGG No data
1121721866_1121721872 3 Left 1121721866 14:96115004-96115026 CCCATTTCTAGTGGATGAGCTTG No data
Right 1121721872 14:96115030-96115052 CAGAGGGGTCAAACTGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121721866 Original CRISPR CAAGCTCATCCACTAGAAAT GGG (reversed) Intergenic
No off target data available for this crispr