ID: 1121721872

View in Genome Browser
Species Human (GRCh38)
Location 14:96115030-96115052
Sequence CAGAGGGGTCAAACTGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121721866_1121721872 3 Left 1121721866 14:96115004-96115026 CCCATTTCTAGTGGATGAGCTTG No data
Right 1121721872 14:96115030-96115052 CAGAGGGGTCAAACTGTGAGAGG No data
1121721867_1121721872 2 Left 1121721867 14:96115005-96115027 CCATTTCTAGTGGATGAGCTTGT No data
Right 1121721872 14:96115030-96115052 CAGAGGGGTCAAACTGTGAGAGG No data
1121721865_1121721872 11 Left 1121721865 14:96114996-96115018 CCAGCAGTCCCATTTCTAGTGGA No data
Right 1121721872 14:96115030-96115052 CAGAGGGGTCAAACTGTGAGAGG No data
1121721863_1121721872 12 Left 1121721863 14:96114995-96115017 CCCAGCAGTCCCATTTCTAGTGG No data
Right 1121721872 14:96115030-96115052 CAGAGGGGTCAAACTGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121721872 Original CRISPR CAGAGGGGTCAAACTGTGAG AGG Intergenic
No off target data available for this crispr