ID: 1121721873

View in Genome Browser
Species Human (GRCh38)
Location 14:96115053-96115075
Sequence CTTTTTCCCATTTATCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121721867_1121721873 25 Left 1121721867 14:96115005-96115027 CCATTTCTAGTGGATGAGCTTGT No data
Right 1121721873 14:96115053-96115075 CTTTTTCCCATTTATCCCCTTGG No data
1121721866_1121721873 26 Left 1121721866 14:96115004-96115026 CCCATTTCTAGTGGATGAGCTTG No data
Right 1121721873 14:96115053-96115075 CTTTTTCCCATTTATCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121721873 Original CRISPR CTTTTTCCCATTTATCCCCT TGG Intergenic
No off target data available for this crispr