ID: 1121722305

View in Genome Browser
Species Human (GRCh38)
Location 14:96118062-96118084
Sequence CATGCGCCAGCACTTGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121722294_1121722305 12 Left 1121722294 14:96118027-96118049 CCTCCTCTGATTCTTCCCTTGGG No data
Right 1121722305 14:96118062-96118084 CATGCGCCAGCACTTGGGAGGGG No data
1121722292_1121722305 29 Left 1121722292 14:96118010-96118032 CCAGCATCTGCATCTCTCCTCCT No data
Right 1121722305 14:96118062-96118084 CATGCGCCAGCACTTGGGAGGGG No data
1121722299_1121722305 -4 Left 1121722299 14:96118043-96118065 CCTTGGGGTGAGCTGTCCTCATG No data
Right 1121722305 14:96118062-96118084 CATGCGCCAGCACTTGGGAGGGG No data
1121722297_1121722305 9 Left 1121722297 14:96118030-96118052 CCTCTGATTCTTCCCTTGGGGTG 0: 101
1: 183
2: 240
3: 296
4: 369
Right 1121722305 14:96118062-96118084 CATGCGCCAGCACTTGGGAGGGG No data
1121722298_1121722305 -3 Left 1121722298 14:96118042-96118064 CCCTTGGGGTGAGCTGTCCTCAT No data
Right 1121722305 14:96118062-96118084 CATGCGCCAGCACTTGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121722305 Original CRISPR CATGCGCCAGCACTTGGGAG GGG Intergenic
No off target data available for this crispr