ID: 1121722812

View in Genome Browser
Species Human (GRCh38)
Location 14:96122765-96122787
Sequence CATGATTCACAGAAGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121722807_1121722812 1 Left 1121722807 14:96122741-96122763 CCTAGGTCAGGATGAGATGTAGC No data
Right 1121722812 14:96122765-96122787 CATGATTCACAGAAGGGGCTGGG No data
1121722803_1121722812 28 Left 1121722803 14:96122714-96122736 CCTCAGGGGAGAAGGCCTGAGTT No data
Right 1121722812 14:96122765-96122787 CATGATTCACAGAAGGGGCTGGG No data
1121722805_1121722812 13 Left 1121722805 14:96122729-96122751 CCTGAGTTTTGACCTAGGTCAGG No data
Right 1121722812 14:96122765-96122787 CATGATTCACAGAAGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121722812 Original CRISPR CATGATTCACAGAAGGGGCT GGG Intergenic
No off target data available for this crispr