ID: 1121724743

View in Genome Browser
Species Human (GRCh38)
Location 14:96138992-96139014
Sequence TCCACCACACTGTACTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121724741_1121724743 10 Left 1121724741 14:96138959-96138981 CCATAGACTGGTGGCCTGTTGGA No data
Right 1121724743 14:96138992-96139014 TCCACCACACTGTACTAAGTAGG No data
1121724739_1121724743 11 Left 1121724739 14:96138958-96138980 CCCATAGACTGGTGGCCTGTTGG No data
Right 1121724743 14:96138992-96139014 TCCACCACACTGTACTAAGTAGG No data
1121724735_1121724743 22 Left 1121724735 14:96138947-96138969 CCTCTACTCCTCCCATAGACTGG No data
Right 1121724743 14:96138992-96139014 TCCACCACACTGTACTAAGTAGG No data
1121724738_1121724743 14 Left 1121724738 14:96138955-96138977 CCTCCCATAGACTGGTGGCCTGT No data
Right 1121724743 14:96138992-96139014 TCCACCACACTGTACTAAGTAGG No data
1121724742_1121724743 -4 Left 1121724742 14:96138973-96138995 CCTGTTGGACATCACATTATCCA No data
Right 1121724743 14:96138992-96139014 TCCACCACACTGTACTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121724743 Original CRISPR TCCACCACACTGTACTAAGT AGG Intergenic
No off target data available for this crispr