ID: 1121724925

View in Genome Browser
Species Human (GRCh38)
Location 14:96140274-96140296
Sequence GAGGGTAAAGAGAAGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121724925_1121724934 15 Left 1121724925 14:96140274-96140296 CCATCTCCCTTCTCTTTACCCTC No data
Right 1121724934 14:96140312-96140334 AGGTCCTTCCTCTGAACCTCTGG No data
1121724925_1121724929 -5 Left 1121724925 14:96140274-96140296 CCATCTCCCTTCTCTTTACCCTC No data
Right 1121724929 14:96140292-96140314 CCCTCTATCCTCATTGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121724925 Original CRISPR GAGGGTAAAGAGAAGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr