ID: 1121726287

View in Genome Browser
Species Human (GRCh38)
Location 14:96153433-96153455
Sequence CTGTAATCTCAGCTAGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121726287_1121726293 25 Left 1121726287 14:96153433-96153455 CCCTCAACTAGCTGAGATTACAG No data
Right 1121726293 14:96153481-96153503 TTTTGTATTTTTAGTAGAGACGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121726287 Original CRISPR CTGTAATCTCAGCTAGTTGA GGG (reversed) Intergenic
No off target data available for this crispr