ID: 1121726723

View in Genome Browser
Species Human (GRCh38)
Location 14:96157655-96157677
Sequence GGGTTGTGGTGTGCTGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121726723_1121726732 1 Left 1121726723 14:96157655-96157677 CCACCTGCAGCACACCACAACCC No data
Right 1121726732 14:96157679-96157701 TTTCCTGGGTAGGTAATAGCTGG No data
1121726723_1121726728 -9 Left 1121726723 14:96157655-96157677 CCACCTGCAGCACACCACAACCC No data
Right 1121726728 14:96157669-96157691 CCACAACCCCTTTCCTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121726723 Original CRISPR GGGTTGTGGTGTGCTGCAGG TGG (reversed) Intergenic
No off target data available for this crispr