ID: 1121731233

View in Genome Browser
Species Human (GRCh38)
Location 14:96188576-96188598
Sequence TATAAGAACACATTGGATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121731233_1121731241 17 Left 1121731233 14:96188576-96188598 CCCTAATCCAATGTGTTCTTATA No data
Right 1121731241 14:96188616-96188638 GACACGGATGCGCACACACAGGG No data
1121731233_1121731239 1 Left 1121731233 14:96188576-96188598 CCCTAATCCAATGTGTTCTTATA No data
Right 1121731239 14:96188600-96188622 AAAAGGGAGTAACTTGGACACGG No data
1121731233_1121731238 -5 Left 1121731233 14:96188576-96188598 CCCTAATCCAATGTGTTCTTATA No data
Right 1121731238 14:96188594-96188616 TTATATAAAAGGGAGTAACTTGG No data
1121731233_1121731240 16 Left 1121731233 14:96188576-96188598 CCCTAATCCAATGTGTTCTTATA No data
Right 1121731240 14:96188615-96188637 GGACACGGATGCGCACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121731233 Original CRISPR TATAAGAACACATTGGATTA GGG (reversed) Intergenic
No off target data available for this crispr