ID: 1121731235

View in Genome Browser
Species Human (GRCh38)
Location 14:96188583-96188605
Sequence CCTTTTATATAAGAACACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121731235_1121731239 -6 Left 1121731235 14:96188583-96188605 CCAATGTGTTCTTATATAAAAGG No data
Right 1121731239 14:96188600-96188622 AAAAGGGAGTAACTTGGACACGG No data
1121731235_1121731240 9 Left 1121731235 14:96188583-96188605 CCAATGTGTTCTTATATAAAAGG No data
Right 1121731240 14:96188615-96188637 GGACACGGATGCGCACACACAGG No data
1121731235_1121731241 10 Left 1121731235 14:96188583-96188605 CCAATGTGTTCTTATATAAAAGG No data
Right 1121731241 14:96188616-96188638 GACACGGATGCGCACACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121731235 Original CRISPR CCTTTTATATAAGAACACAT TGG (reversed) Intergenic
No off target data available for this crispr