ID: 1121731239

View in Genome Browser
Species Human (GRCh38)
Location 14:96188600-96188622
Sequence AAAAGGGAGTAACTTGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121731235_1121731239 -6 Left 1121731235 14:96188583-96188605 CCAATGTGTTCTTATATAAAAGG No data
Right 1121731239 14:96188600-96188622 AAAAGGGAGTAACTTGGACACGG No data
1121731234_1121731239 0 Left 1121731234 14:96188577-96188599 CCTAATCCAATGTGTTCTTATAT No data
Right 1121731239 14:96188600-96188622 AAAAGGGAGTAACTTGGACACGG No data
1121731233_1121731239 1 Left 1121731233 14:96188576-96188598 CCCTAATCCAATGTGTTCTTATA No data
Right 1121731239 14:96188600-96188622 AAAAGGGAGTAACTTGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121731239 Original CRISPR AAAAGGGAGTAACTTGGACA CGG Intergenic
No off target data available for this crispr