ID: 1121731861

View in Genome Browser
Species Human (GRCh38)
Location 14:96192941-96192963
Sequence CTTTTCTGCACCTGGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121731854_1121731861 10 Left 1121731854 14:96192908-96192930 CCACCTGATGAGGGTGGCAAATG No data
Right 1121731861 14:96192941-96192963 CTTTTCTGCACCTGGGGTGCAGG No data
1121731855_1121731861 7 Left 1121731855 14:96192911-96192933 CCTGATGAGGGTGGCAAATGCTC No data
Right 1121731861 14:96192941-96192963 CTTTTCTGCACCTGGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121731861 Original CRISPR CTTTTCTGCACCTGGGGTGC AGG Intergenic
No off target data available for this crispr