ID: 1121731889

View in Genome Browser
Species Human (GRCh38)
Location 14:96193077-96193099
Sequence CAGCCAGCTCCCAGATGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121731886_1121731889 4 Left 1121731886 14:96193050-96193072 CCCGTCCAAGGAGGGTGGCAGAA No data
Right 1121731889 14:96193077-96193099 CAGCCAGCTCCCAGATGCATTGG No data
1121731887_1121731889 3 Left 1121731887 14:96193051-96193073 CCGTCCAAGGAGGGTGGCAGAAG No data
Right 1121731889 14:96193077-96193099 CAGCCAGCTCCCAGATGCATTGG No data
1121731888_1121731889 -1 Left 1121731888 14:96193055-96193077 CCAAGGAGGGTGGCAGAAGCTGC No data
Right 1121731889 14:96193077-96193099 CAGCCAGCTCCCAGATGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121731889 Original CRISPR CAGCCAGCTCCCAGATGCAT TGG Intergenic
No off target data available for this crispr