ID: 1121732047

View in Genome Browser
Species Human (GRCh38)
Location 14:96193889-96193911
Sequence TCCGATGTGTAGCGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121732034_1121732047 21 Left 1121732034 14:96193845-96193867 CCACTCTCATGACTCGCCAGGAG No data
Right 1121732047 14:96193889-96193911 TCCGATGTGTAGCGGGTAGAGGG No data
1121732039_1121732047 -3 Left 1121732039 14:96193869-96193891 CCAGGGGACCCTTTGCCACCTCC No data
Right 1121732047 14:96193889-96193911 TCCGATGTGTAGCGGGTAGAGGG No data
1121732032_1121732047 30 Left 1121732032 14:96193836-96193858 CCAGGACTGCCACTCTCATGACT No data
Right 1121732047 14:96193889-96193911 TCCGATGTGTAGCGGGTAGAGGG No data
1121732038_1121732047 5 Left 1121732038 14:96193861-96193883 CCAGGAGACCAGGGGACCCTTTG No data
Right 1121732047 14:96193889-96193911 TCCGATGTGTAGCGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121732047 Original CRISPR TCCGATGTGTAGCGGGTAGA GGG Intergenic
No off target data available for this crispr