ID: 1121732125

View in Genome Browser
Species Human (GRCh38)
Location 14:96194307-96194329
Sequence TGCTGCATAGGGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121732112_1121732125 29 Left 1121732112 14:96194255-96194277 CCATAGAGGAGGTATGCTGCATG No data
Right 1121732125 14:96194307-96194329 TGCTGCATAGGGAGGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121732125 Original CRISPR TGCTGCATAGGGAGGGCAGA AGG Intergenic
No off target data available for this crispr