ID: 1121732821

View in Genome Browser
Species Human (GRCh38)
Location 14:96198112-96198134
Sequence CTGGTGCTGGGACGTCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121732821_1121732829 29 Left 1121732821 14:96198112-96198134 CCAGGCGGACGTCCCAGCACCAG No data
Right 1121732829 14:96198164-96198186 AGACGACAGCCCCGCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121732821 Original CRISPR CTGGTGCTGGGACGTCCGCC TGG (reversed) Intergenic
No off target data available for this crispr