ID: 1121734067

View in Genome Browser
Species Human (GRCh38)
Location 14:96205748-96205770
Sequence CTTTATGCAAAGATAGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121734064_1121734067 -10 Left 1121734064 14:96205735-96205757 CCTGGAAGTTCCTCTTTATGCAA 0: 1
1: 0
2: 2
3: 6
4: 174
Right 1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG 0: 1
1: 0
2: 1
3: 13
4: 184
1121734061_1121734067 15 Left 1121734061 14:96205710-96205732 CCTGTCTCCTGAGCTATAAAGAA 0: 1
1: 0
2: 2
3: 33
4: 286
Right 1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG 0: 1
1: 0
2: 1
3: 13
4: 184
1121734062_1121734067 8 Left 1121734062 14:96205717-96205739 CCTGAGCTATAAAGAAGACCTGG 0: 1
1: 1
2: 19
3: 559
4: 4231
Right 1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG 0: 1
1: 0
2: 1
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121734067 Original CRISPR CTTTATGCAAAGATAGAGGT AGG Intronic
900176178 1:1292403-1292425 CTTTATTCAAAGCGAGGGGTGGG + Exonic
905683680 1:39893259-39893281 TTTCAGACAAAGATAGAGGTAGG + Intergenic
907396442 1:54193661-54193683 CTTTTTATAAAGATAGAGATGGG - Intronic
910122527 1:83806264-83806286 CTTTTTGGAAAGAAACAGGTAGG + Intergenic
910335687 1:86127610-86127632 ATTTATACAAAGATACAGATGGG - Intronic
910404837 1:86876604-86876626 CTTTATGTAAAGATATAGATTGG + Intronic
910791189 1:91052900-91052922 CTTTATGCAAAGAAAGACTTAGG + Intergenic
912417828 1:109522104-109522126 CTTTATGAAATGAGAGAGTTAGG + Intergenic
913258924 1:116981230-116981252 CTTTAGGAAAAGGCAGAGGTGGG - Intronic
915247329 1:154565927-154565949 CTTAAGGAAAAGATAGAGGGTGG - Intergenic
918094017 1:181319754-181319776 ATTTATGCTAGGTTAGAGGTAGG + Intergenic
918192226 1:182186834-182186856 CATGATGGAAAGAGAGAGGTTGG + Intergenic
919957489 1:202433455-202433477 CTGTAGGCAAAGATAGAGTGAGG - Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
924566909 1:245206355-245206377 CTTTGTGCAAAGATAAAGGAGGG - Intronic
924663312 1:246043065-246043087 ATTTATGTGTAGATAGAGGTGGG - Intronic
1063020940 10:2127093-2127115 CATTATGCAAACAGAGAGGGTGG - Intergenic
1063027730 10:2198708-2198730 CTTAATGCAAAAACAAAGGTAGG - Intergenic
1063745662 10:8877708-8877730 CTATATACAAAGATAGTTGTTGG + Intergenic
1064669120 10:17690808-17690830 TTTGATGTAAAGATAGAAGTAGG + Intronic
1064979142 10:21148894-21148916 CTTTATGGAAAGGTAGGGGAAGG - Intronic
1065037657 10:21656224-21656246 CTTGATGGAAAGATAGGGATAGG + Intronic
1065830631 10:29610755-29610777 ATTCATGAAAAGATGGAGGTTGG - Intronic
1066202246 10:33152912-33152934 CTTTATCAAAGGGTAGAGGTTGG + Intergenic
1070142662 10:73749955-73749977 CTTTATGAAAGCATAGAGTTTGG - Intronic
1072046905 10:91666290-91666312 CTTGATGGAGAGATAGAGGGTGG + Intergenic
1077590386 11:3486447-3486469 CATAATGAAAAGTTAGAGGTCGG + Intergenic
1080834044 11:35923290-35923312 CTTGATGCCAGGATAGAGGCAGG - Intergenic
1083836875 11:65275564-65275586 CTGTTTGAAAACATAGAGGTAGG + Intronic
1084403174 11:68956449-68956471 CTTTAAGCAGACATAGAGGAGGG - Intergenic
1084826573 11:71736273-71736295 CATAATGAAAAGTTAGAGGTCGG - Intergenic
1088298111 11:108323095-108323117 CTTTATGCAAAAATAAAATTTGG + Intronic
1088318061 11:108527376-108527398 CTTTTTGCAAAGAGAGAGGGAGG + Intronic
1088346533 11:108833335-108833357 CTTTTTCCATAGATAGAGTTGGG + Intronic
1091324896 11:134678763-134678785 CTTCAGGCAAACACAGAGGTGGG + Intergenic
1093827970 12:23718396-23718418 CTGTATGCAAAGATTAAGATAGG - Intronic
1094744437 12:33328593-33328615 ACTTATGCAATAATAGAGGTTGG - Intergenic
1095510512 12:42946698-42946720 CTGTTTGCAAAGATAGCTGTAGG - Intergenic
1097561852 12:61217046-61217068 CTTTATGTAAAGAAAAAAGTTGG + Intergenic
1100109457 12:91220888-91220910 CTAAATGGAAAGATAGAGATAGG + Intergenic
1100250634 12:92819369-92819391 CTTTATGCAAAAATTCAGGCTGG - Exonic
1106911796 13:34470981-34471003 CTCTATGCAAACATAGATGAGGG - Intergenic
1107343336 13:39433087-39433109 CCTTATGCCAATTTAGAGGTAGG + Intronic
1113261249 13:108566066-108566088 CTTTCTCAAAAGATAGAGGAGGG - Intergenic
1115153139 14:30308510-30308532 CTTTCAGGAAAAATAGAGGTTGG + Intergenic
1117894328 14:60465090-60465112 TTTTATTTAAGGATAGAGGTAGG - Intronic
1119359140 14:74033264-74033286 CTTTATGCAAAAATAAAAGGGGG + Intronic
1121302291 14:92881334-92881356 CTCTGTGCAAAGAGGGAGGTGGG - Intergenic
1121656423 14:95599677-95599699 CTTTAAGCAAAGATAGACTAGGG - Intergenic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1127349600 15:58137218-58137240 CTTTTTGCAAAGCTAGGGGAGGG + Intronic
1127651333 15:61011065-61011087 ATTTAAGCAAAGGCAGAGGTAGG + Intronic
1128496822 15:68203485-68203507 CTTTTTGTACAGATAGATGTAGG + Intronic
1128672499 15:69585130-69585152 GTTTATGATAAGATAGAGGTTGG + Intergenic
1129011251 15:72419678-72419700 CTCTATGCAAAGAAAAAGGAGGG + Intergenic
1129643829 15:77411780-77411802 CTTTTTGTAAAGATGGGGGTTGG + Intronic
1133355755 16:5135516-5135538 CATAATGAAAAGTTAGAGGTCGG + Intergenic
1133640754 16:7714995-7715017 CTTCATGCAGAAATAGAGGCTGG + Intergenic
1133825939 16:9278341-9278363 TTTTATGCCAAGGTAGAGTTTGG + Intergenic
1138142436 16:54580454-54580476 CTTTAGACAAAGACTGAGGTGGG - Intergenic
1139107747 16:63848593-63848615 CTTTAAGCAAAGTTATAAGTGGG + Intergenic
1142860691 17:2759252-2759274 ACTTGTGCAAAGATAGTGGTTGG + Intergenic
1143858088 17:9867494-9867516 TCTTATACAAAGAAAGAGGTGGG - Intronic
1143975208 17:10824414-10824436 CTAGATGCAGAGATAGAGGCAGG + Exonic
1146561719 17:33875672-33875694 CTTAGTGCACAGATAGAAGTTGG - Intronic
1148548066 17:48531717-48531739 ATTTATGCAAAGAGAGAGAGAGG - Intergenic
1150968377 17:69998219-69998241 CTTTATTCAGAGATAGGTGTGGG + Intergenic
1153123365 18:1759613-1759635 ATTTATACAAAGATATAGATTGG - Intergenic
1153160398 18:2198284-2198306 CTATATACAAAGAGATAGGTTGG + Intergenic
1156272013 18:35544320-35544342 CTTTATAGAAAGATAGAGGAGGG + Intergenic
1158593158 18:58794305-58794327 CTTCCTGCACAAATAGAGGTGGG + Intergenic
1165118045 19:33540962-33540984 CGTCATGCAAAGACAGAGGCAGG - Intergenic
1165641011 19:37386670-37386692 CTATATGTAAAGATAGTGGTTGG + Intronic
1166070812 19:40386529-40386551 CTTTTTGTAGAGATAGAGATGGG + Intronic
925717666 2:6799439-6799461 CATTTTACAAAGGTAGAGGTAGG + Intergenic
926781137 2:16473007-16473029 CTTTATGCAATGAAAGAGTCTGG - Intergenic
928172789 2:29014152-29014174 CTTTATTCCAAGATAGGTGTGGG - Intronic
928332151 2:30365863-30365885 TTTCATCCAAAGAAAGAGGTTGG - Intergenic
929175641 2:38972612-38972634 CATTATTCAAAGAAAGAAGTTGG - Intronic
930320906 2:49853735-49853757 TTTTATCCATAGATAGGGGTAGG - Intergenic
930491711 2:52082071-52082093 CTTTATGTATGGATACAGGTAGG + Intergenic
931938886 2:67230528-67230550 CTTGATACAATGATAGAGGCAGG + Intergenic
933696242 2:85220253-85220275 CTTTAAGAAAAAAAAGAGGTGGG + Intronic
935809703 2:106785631-106785653 CATTATGAAAAAATAGATGTTGG + Intergenic
938712449 2:133987196-133987218 TTTTCTGTAAAGGTAGAGGTAGG - Intergenic
939472681 2:142644538-142644560 CCTTTTCCAAAGAGAGAGGTAGG + Intergenic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
941351561 2:164443519-164443541 TTTTATGGAAAGATGGAGATTGG - Intergenic
942188887 2:173451409-173451431 CTTTATGCAAAAATACCTGTAGG - Intergenic
942303568 2:174585485-174585507 CTTTATGCATAGAAAGTGTTTGG + Intronic
945117826 2:206426488-206426510 CTTTATTGAAAGATAGACATGGG - Intergenic
945318772 2:208397556-208397578 CTCTGTACAGAGATAGAGGTGGG + Intronic
947025379 2:225732215-225732237 CTGTATTCAAAGATAGAGGTAGG + Intergenic
1169927683 20:10799992-10800014 CTTTGTGCAAATACAGAGGCTGG + Intergenic
1170677004 20:18491702-18491724 CTTTGTGCCAAGAAAGAGTTAGG + Intronic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1171858697 20:30375373-30375395 CTCTATGCATATATAGAGGCTGG + Intergenic
1172369829 20:34380622-34380644 TTTTTTGCAAAAATAGAGATGGG + Intronic
1173703312 20:45092314-45092336 CATTATGCAAATAAAGAGCTGGG - Exonic
1174630626 20:51953876-51953898 CTTTGTACAAAGAGAGAGGGAGG - Intergenic
1176931784 21:14821041-14821063 TTTTATGCAAACATAGATGAGGG + Intergenic
1177089219 21:16745664-16745686 GTTTATGCAAACAAAAAGGTAGG - Intergenic
1177801526 21:25833379-25833401 ATTGATACAATGATAGAGGTAGG + Intergenic
1177922891 21:27175283-27175305 CTTTATGCAGAAAAAGATGTCGG - Intergenic
1177968403 21:27758692-27758714 CTTGATGCAATGATAGAGGCAGG + Intergenic
1180298191 22:10963304-10963326 CTCTATGCATATATAGAGGCTGG - Intergenic
1180410222 22:12600495-12600517 CTCTATGCATATATAGAGGCTGG + Intergenic
1183909480 22:41067735-41067757 CTTTATGCTAAGAGAGGGGTAGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185193814 22:49455577-49455599 CTTTATGCAAAGCGTGAGGCAGG + Intronic
949569163 3:5275290-5275312 CTTTATAGAAAGATACAGGATGG + Intergenic
953008940 3:39005458-39005480 CATTATGCGAAGCCAGAGGTAGG - Intergenic
953207717 3:40846579-40846601 CTTTTTACAAAGATAGATGGTGG + Intergenic
953967249 3:47318832-47318854 ATTTATCCAAGGATTGAGGTTGG - Intronic
955362007 3:58283697-58283719 GTTAATGCAGAGATGGAGGTTGG + Intronic
957148101 3:76449894-76449916 CTTGCTGCAAATATAGAGTTGGG + Intronic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
959562258 3:107796095-107796117 CTTCATTCAGAGATGGAGGTTGG - Intronic
959771633 3:110105958-110105980 CTTTATAAAAAGATATAAGTTGG - Intergenic
961555133 3:127691970-127691992 CTTTATGCAAAAAAAGAGAAAGG - Exonic
961599007 3:128044268-128044290 CTTTAGGCAAAGATGGATTTAGG - Intergenic
961894224 3:130153955-130153977 CATAATGAAAAGTTAGAGGTCGG + Intergenic
964994117 3:162853583-162853605 CATTATGCCAACATAGAGGAGGG - Intergenic
965096760 3:164239030-164239052 TTTTAGACAAAGATAGTGGTCGG + Intergenic
965166907 3:165206086-165206108 CGTGATGCAATGATAGAAGTAGG + Intergenic
965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG + Intronic
967439041 3:189485652-189485674 CTTTATTCTAAGAAAGAGGAGGG - Intergenic
968844906 4:3035591-3035613 CTTTTTTCAAAAATAGAGATGGG + Intronic
969004318 4:4007028-4007050 CATAATGAAAAGTTAGAGGTCGG + Intergenic
969748543 4:9093121-9093143 CATAATGAAAAGTTAGAGGTCGG - Intergenic
969809580 4:9637686-9637708 CATAATGAAAAGTTAGAGGTCGG - Intergenic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
971215611 4:24659642-24659664 CTGTATGCAAAGATATTGCTTGG + Intergenic
971430906 4:26566234-26566256 ATTTATGCAAAGACAGAGAAAGG + Intergenic
971959878 4:33471675-33471697 CTCAAAGCAATGATAGAGGTAGG - Intergenic
974064206 4:57062582-57062604 CTTTATTCTAAGATATGGGTAGG - Intronic
974645892 4:64692058-64692080 CTGTATGGAAATATACAGGTGGG - Intergenic
974731640 4:65874374-65874396 CTTTATTCAAGGATACAGTTGGG + Intergenic
976098822 4:81538563-81538585 CATTATGCAAAGATAAAGAGGGG - Intronic
976776048 4:88707129-88707151 CTTTTTGAAAAATTAGAGGTTGG + Exonic
976855246 4:89597023-89597045 CTTTTTGCAATGATACAGTTAGG + Intergenic
977509331 4:97941609-97941631 TTTTATGCAAAGATACAACTGGG + Intronic
979701792 4:123676724-123676746 CTTTATGCATAGCTCAAGGTAGG - Intergenic
980463499 4:133147807-133147829 TTTTATGCAAAGAGATAGGAAGG - Intergenic
981949613 4:150390474-150390496 CTTTATTCACAGTTAGTGGTAGG - Intronic
983035278 4:162857358-162857380 CTTTTTCCAAAAATAGAGATGGG + Intergenic
983800401 4:171921868-171921890 CTCTAAGCAAATATAGAGTTTGG - Intronic
987871360 5:23622452-23622474 ATGGATGCAAAGATAGACGTTGG + Intergenic
990854590 5:60249686-60249708 CATTTTGCAAAGATACAGGTAGG + Intronic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
993623913 5:90200845-90200867 CTTTAAGCAAAAATAGACCTAGG + Intergenic
995392615 5:111655127-111655149 CTTTATGCAACAAGAGAGGAAGG - Intergenic
998493448 5:142566586-142566608 GTTTATAAAAAGATAGAGGTTGG + Intergenic
1000047435 5:157533264-157533286 TTTGATGCAAAGACAGGGGTTGG - Intronic
1000096577 5:157976312-157976334 CTTTATTGAAAGTTGGAGGTAGG + Intergenic
1000212801 5:159123435-159123457 CTTTTTCCAAAAATAGAGGGGGG - Intergenic
1000435347 5:161201056-161201078 CTTTCTGAGAAGATAGAAGTTGG + Intergenic
1005154091 6:22783898-22783920 CTTTATGCCAAGGTAGATTTTGG + Intergenic
1005979475 6:30825544-30825566 CTTTATGAAAAGTTAGGGATAGG - Intergenic
1007268555 6:40617214-40617236 CTTTATGCAAAGAAAACCGTAGG - Intergenic
1008159824 6:48063425-48063447 CTTTATACTAAGAAAGAAGTAGG - Intronic
1011509855 6:88088466-88088488 CCTTATGGAAAAATAGAGGCAGG + Intergenic
1014885569 6:126776639-126776661 CTTTATGAAAATAAAGAAGTGGG + Intergenic
1016530494 6:145053999-145054021 CTTTATGAGAAGACAGGGGTTGG - Intergenic
1019473214 7:1232129-1232151 CTATCTACAAAGACAGAGGTGGG - Intergenic
1020324450 7:6963529-6963551 CATAATGAAAAGTTAGAGGTCGG + Intergenic
1020672719 7:11137936-11137958 CTTTATACAAGGAAAGAGCTAGG - Intronic
1021490208 7:21211326-21211348 GTTTAGGAACAGATAGAGGTAGG + Intergenic
1028223764 7:88226194-88226216 CTTTATGAAAAAATAGACCTAGG - Intronic
1037706030 8:21315950-21315972 ATCTATGCACAGATTGAGGTTGG - Intergenic
1038235263 8:25746695-25746717 CCTTATTCTAACATAGAGGTGGG - Intergenic
1039687691 8:39823380-39823402 CTTTTTCCTAGGATAGAGGTAGG + Intronic
1041081707 8:54220853-54220875 CTTTATTTACAGATTGAGGTGGG + Intergenic
1044903929 8:96979192-96979214 CTGGATGCAAAGCTAAAGGTTGG + Intronic
1047242806 8:123108491-123108513 TTTTAAGGAAAGAGAGAGGTGGG + Intronic
1047312737 8:123706317-123706339 CTGAATGGAAAGAAAGAGGTAGG - Intronic
1048238999 8:132721856-132721878 CTTTGTGAGAGGATAGAGGTGGG + Intronic
1052446161 9:28564443-28564465 CTGTAATCTAAGATAGAGGTAGG - Intronic
1053724972 9:40990563-40990585 CTCTATGCATATATAGAGGCTGG + Intergenic
1054340996 9:63861438-63861460 CTCTATGCATATATAGAGGCTGG - Intergenic
1055113297 9:72580989-72581011 CTTTCTGCAAATATAGAGAGAGG - Intronic
1055406895 9:75984376-75984398 GTTTATGCACACATATAGGTTGG + Intronic
1055696825 9:78894017-78894039 CTTTATGCTGACATATAGGTTGG - Intergenic
1055770036 9:79707107-79707129 CTTTTTGCAAGGATAGAAGAGGG + Exonic
1056943748 9:90976521-90976543 CTTTATCTAAGAATAGAGGTAGG - Intergenic
1058633131 9:107009694-107009716 CTTTGTCCAAAGCAAGAGGTAGG + Intronic
1059092812 9:111378895-111378917 CTTGAAGCATATATAGAGGTAGG + Intronic
1059731088 9:117057948-117057970 CTTTATGAAGAAAGAGAGGTGGG - Intronic
1059902503 9:118943877-118943899 CTTTGAGCAAAGAAAGAGTTGGG - Intergenic
1062623076 9:137431282-137431304 CTCGATGCAGAGACAGAGGTCGG + Exonic
1185993530 X:4918045-4918067 CTGTATGGAAAGAAAGAGATAGG - Intergenic
1186039732 X:5462676-5462698 TTTTAGGCAAAGATACAGTTTGG + Intergenic
1186215529 X:7296330-7296352 CTTCTTGCAAAGATAGAGATTGG - Intronic
1189951062 X:46231266-46231288 CATTATTCAATGATGGAGGTGGG + Intergenic
1192003548 X:67183558-67183580 TTTTATGCAAACCAAGAGGTGGG - Intergenic
1192288051 X:69759733-69759755 CTTCTTGGAAAGGTAGAGGTTGG + Intronic
1196746589 X:119076551-119076573 ATTTTTGCAAAGAGAGAGATGGG + Intergenic
1198380893 X:136082386-136082408 AATTATGCAAAAATAGAGATGGG + Intergenic
1201547233 Y:15178917-15178939 TTTTAGGCAAAGATATAGTTTGG - Intergenic