ID: 1121734577

View in Genome Browser
Species Human (GRCh38)
Location 14:96209033-96209055
Sequence GACCACTTAGGAAACCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121734577_1121734583 -3 Left 1121734577 14:96209033-96209055 CCCTGCGGGTTTCCTAAGTGGTC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1121734583 14:96209053-96209075 GTCACACTCCAGTGGCAGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 209
1121734577_1121734581 -7 Left 1121734577 14:96209033-96209055 CCCTGCGGGTTTCCTAAGTGGTC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1121734581 14:96209049-96209071 AGTGGTCACACTCCAGTGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 118
1121734577_1121734582 -6 Left 1121734577 14:96209033-96209055 CCCTGCGGGTTTCCTAAGTGGTC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1121734582 14:96209050-96209072 GTGGTCACACTCCAGTGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 156
1121734577_1121734585 5 Left 1121734577 14:96209033-96209055 CCCTGCGGGTTTCCTAAGTGGTC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1121734585 14:96209061-96209083 CCAGTGGCAGGGTGGTCTGCCGG 0: 1
1: 0
2: 3
3: 29
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121734577 Original CRISPR GACCACTTAGGAAACCCGCA GGG (reversed) Intronic
901377212 1:8848033-8848055 GACCACTTTGGAAATGAGCATGG - Intergenic
902195791 1:14796998-14797020 GGCCACTTAGGTAACACACATGG + Intronic
907896122 1:58693716-58693738 GACCAGTTAGGAAACATTCACGG - Intronic
907955126 1:59220975-59220997 GAGCACTTAGGAGACCCTCATGG - Intergenic
914252429 1:145932718-145932740 AACCACTGAGGAAGGCCGCAGGG + Intergenic
917333366 1:173905170-173905192 GAACACTTAGGAAGACTGCAAGG - Intronic
920176817 1:204107308-204107330 GACAACTTGGAAGACCCGCAGGG - Intronic
1066094466 10:32058994-32059016 GACCAGTTAGAAAACCCAGATGG - Intergenic
1068572318 10:58643765-58643787 GACCATTTAGGAGAACCACAAGG + Intronic
1071931080 10:90470997-90471019 GGCCAGTTAGCAAACCCACATGG - Intergenic
1075962631 10:126582415-126582437 GGACACTTATGAAGCCCGCATGG + Intronic
1079527199 11:21404837-21404859 GACCACTGAGGAAAGCCCCCAGG - Intronic
1085717088 11:78881834-78881856 GAAGACTTAGGAGACCAGCATGG - Intronic
1092818576 12:12332272-12332294 GACCAGTTTGGAAACTGGCATGG - Intronic
1101533091 12:105592619-105592641 CACCACTTTGGAAACCTGTATGG + Intergenic
1102583312 12:113906038-113906060 AACCACTTTGGAAACCTGCCTGG + Intronic
1106466118 13:30015986-30016008 GATCAGTTAGGGAACCAGCAGGG - Intergenic
1108069483 13:46613524-46613546 GACCACTTACCAAAACCACATGG - Intronic
1117924832 14:60767530-60767552 GATCAATTAGAAAACCCGGAAGG - Intronic
1118678754 14:68217146-68217168 CACCACTTAGGAGAGCAGCAGGG - Intronic
1121734577 14:96209033-96209055 GACCACTTAGGAAACCCGCAGGG - Intronic
1125513390 15:40304671-40304693 GCCCACCTAGGAAATCCCCAGGG + Intronic
1127915552 15:63452129-63452151 GACCAGTTAGGAAAGCTGCCAGG + Intergenic
1131413057 15:92227114-92227136 TACCCCTTAAGAAACCCGAAAGG - Intergenic
1135549836 16:23389582-23389604 GACCACTTGGAAAACCCAGAGGG + Intronic
1146516608 17:33494578-33494600 GACCATTCAGAAAACCCTCACGG + Intronic
1147320673 17:39644053-39644075 GACCCCTTGGGAAGCCCCCATGG + Intronic
1149395656 17:56239703-56239725 TTCCACTTGGGAAACCCACAAGG + Intronic
1151830858 17:76549539-76549561 AACCACTTGGGAAACCAGCATGG + Intronic
1152066344 17:78114687-78114709 GACCACTTAGAATACCTTCAAGG + Intronic
1155554261 18:27000842-27000864 CACAACTTTGGAAACCCACATGG - Intronic
1155750698 18:29419722-29419744 GCCCTCTTAGGAAACCCTCCAGG + Intergenic
931562615 2:63578958-63578980 GGCCACTTAGGAAGACCTCAGGG - Intronic
942504846 2:176630833-176630855 GACCAGTTAAGAAACCTGCCAGG + Intergenic
948666093 2:239535750-239535772 GGCCATTTAGGAGACCCTCAGGG - Intergenic
1172827106 20:37798580-37798602 CACCACTTAGGCAAGCAGCATGG - Intronic
1181297110 22:21848286-21848308 GAACACTGAGGAAGGCCGCAGGG + Intronic
1181663383 22:24371134-24371156 GACCAGATAGAAAACCAGCAAGG + Intronic
1181912845 22:26254167-26254189 GACCCCTTAGGAAAGCAACACGG + Intronic
1182548543 22:31089285-31089307 GGCCACTTGGGGAACCTGCATGG - Intronic
1184717680 22:46291196-46291218 GACCACCAAAGAAACACGCATGG - Intronic
960774366 3:121232111-121232133 GACCACTCAGCAAACCCTGAAGG - Intronic
966948276 3:184793232-184793254 AACCACTAAGGAAAACAGCATGG - Intergenic
970363648 4:15336497-15336519 GACCACTGAGGGATCCCCCAGGG + Intergenic
975544957 4:75550799-75550821 CACCACTTAGGAAAGTCCCAGGG - Intergenic
975794789 4:77995749-77995771 GCCTACCTGGGAAACCCGCATGG - Intergenic
977117936 4:93056089-93056111 GAGCAGTTTGGAAACCTGCAGGG + Intronic
977875782 4:102148498-102148520 TACCACTTAGAAAACCCTGAGGG - Intergenic
990955220 5:61333059-61333081 GGCCAGTGAGGACACCCGCAGGG - Intronic
992567775 5:78017406-78017428 GAACACTTAGGAGAGCAGCATGG + Intronic
994575197 5:101568796-101568818 AATCACTTTGGAAACCTGCATGG + Intergenic
1005846574 6:29784805-29784827 TACCACTTAGGAAATCAGCATGG + Intergenic
1007900725 6:45409384-45409406 GAGCCCTTAGGATACCCACATGG + Intronic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1008516319 6:52322916-52322938 TACCACTCAGGAAAGCCACAGGG - Intergenic
1010118600 6:72345696-72345718 GACCACTTAGTACACCATCACGG + Intronic
1020346439 7:7169429-7169451 AACCACTGTGGAAACCAGCATGG - Intronic
1028382082 7:90211505-90211527 GACCACGGAGGAACCCCGCAGGG + Intronic
1029905990 7:104093889-104093911 GACCACTTAAAACACCAGCAAGG + Intergenic
1035116966 7:156532963-156532985 CACCATTTAGAAAACCAGCATGG - Intergenic
1038401350 8:27287115-27287137 GGCCACATAGGAAAGCCCCACGG - Exonic
1040610860 8:48980759-48980781 CACCAGTTATGAAACCTGCATGG + Intergenic
1040859798 8:51987285-51987307 CACCAGTTAGCAAACCCGGATGG + Intergenic
1043006228 8:74822232-74822254 GACTATTAAGGAAACCCACAAGG - Intronic
1046313113 8:112464753-112464775 CACCACTTAGCAAACCTTCATGG + Intronic
1050507747 9:6365044-6365066 CACCAGTTAGCAAACCCACATGG - Intergenic
1051548447 9:18303177-18303199 GAGGACTCAGGAAACCCTCAAGG + Intergenic
1056984390 9:91347591-91347613 GACCATTCAGGAAACTCCCAGGG + Intronic
1061526376 9:131167553-131167575 AACCACTTAGTAAAACCGCCTGG - Intronic
1196862213 X:120039150-120039172 GACCACTTATCAAATCCCCATGG + Intergenic
1196880889 X:120197194-120197216 GACCACTTATCAAATCCCCATGG - Intergenic
1198773914 X:140159488-140159510 AACCACTTAGGTAACCCGAAAGG - Intergenic