ID: 1121737584

View in Genome Browser
Species Human (GRCh38)
Location 14:96229130-96229152
Sequence CCATTTATTAAACACCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 786
Summary {0: 1, 1: 3, 2: 20, 3: 133, 4: 629}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121737580_1121737584 3 Left 1121737580 14:96229104-96229126 CCTGCCCTCTATCAGTCAGTCAA 0: 1
1: 0
2: 1
3: 15
4: 118
Right 1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG 0: 1
1: 3
2: 20
3: 133
4: 629
1121737579_1121737584 4 Left 1121737579 14:96229103-96229125 CCCTGCCCTCTATCAGTCAGTCA 0: 1
1: 0
2: 1
3: 17
4: 178
Right 1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG 0: 1
1: 3
2: 20
3: 133
4: 629
1121737582_1121737584 -2 Left 1121737582 14:96229109-96229131 CCTCTATCAGTCAGTCAACGACC 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG 0: 1
1: 3
2: 20
3: 133
4: 629
1121737581_1121737584 -1 Left 1121737581 14:96229108-96229130 CCCTCTATCAGTCAGTCAACGAC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG 0: 1
1: 3
2: 20
3: 133
4: 629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121737584 Original CRISPR CCATTTATTAAACACCTACT AGG Intronic
900036350 1:412965-412987 CCATTTATCAAATGCCTACATGG + Intergenic
901309891 1:8261244-8261266 ATATTTATCAAACACCTACTTGG - Intergenic
902365777 1:15973251-15973273 CCATTTATTCAGCACTTCCTTGG - Intronic
902439891 1:16422276-16422298 CCAGTTATTACACACTTACTAGG + Intronic
902466756 1:16623405-16623427 ACATTAACTAAGCACCTACTTGG - Intergenic
902507854 1:16949368-16949390 ACATTAACTAAGCACCTACTTGG + Intronic
902566392 1:17314407-17314429 CCATTTATGATACACCTACCTGG - Intronic
902641778 1:17771420-17771442 ACATTTAATAAACACATAATAGG - Intronic
902774900 1:18668376-18668398 GCATTTACTGAGCACCTACTAGG - Intronic
903032367 1:20472994-20473016 CTATTTATTGAGCACCTACTAGG + Intergenic
903610346 1:24606939-24606961 CCATTTATTAAGCATCTCCTGGG - Exonic
904284094 1:29443073-29443095 ATATTTATCCAACACCTACTAGG + Intergenic
904444393 1:30556262-30556284 TAAATTATTGAACACCTACTAGG + Intergenic
904839199 1:33360617-33360639 CCATTTACTGAGCATCTACTAGG - Intronic
905471056 1:38192084-38192106 CCATTTATTGACCACTTACGAGG + Intergenic
905710266 1:40096372-40096394 ACAGTTATTGAGCACCTACTAGG - Intronic
905812665 1:40923999-40924021 GCATTTCTTGAACACCTACTAGG - Intergenic
906006265 1:42474402-42474424 TCATTTATTGAACACTTGCTAGG - Intronic
906082648 1:43103513-43103535 CCATTTACTGAGCACTTACTTGG + Intergenic
907395420 1:54186380-54186402 CCATTTCTCAGACACCTTCTGGG - Intronic
907545218 1:55253821-55253843 ACATTTACTAAACATCTACTAGG + Intergenic
907709999 1:56871136-56871158 CCATTTATTAAATAATTTCTAGG + Intronic
907737365 1:57127630-57127652 CTACTTATTGAGCACCTACTGGG - Intronic
907763007 1:57380091-57380113 ATATTTATTGAGCACCTACTTGG + Intronic
907779276 1:57550876-57550898 ACATTTATAAAGCACTTACTTGG + Intronic
908000009 1:59670636-59670658 ACATTTACTGATCACCTACTTGG - Intronic
908393069 1:63700738-63700760 CCAAGTATTAAAGGCCTACTAGG - Intergenic
908420427 1:63953633-63953655 CCATTTATTGAGCACCTACTAGG - Intronic
908578882 1:65492404-65492426 ACACTTATTATTCACCTACTAGG + Intronic
909143291 1:71894426-71894448 CCATTTATTCAGCAGTTACTAGG + Intronic
909566845 1:77062162-77062184 TTATTTATTAAGCACCTACCAGG + Intronic
909752780 1:79184189-79184211 TCATTTATTAAGCACCTACTTGG + Intergenic
910116756 1:83739837-83739859 TTATTTATTAAGCACCTACTTGG + Intergenic
910530489 1:88229820-88229842 ACATTTATTACATACCTATTAGG + Intergenic
910548209 1:88444312-88444334 GCATTTATCAAACACCTAGGAGG + Intergenic
910791336 1:91054304-91054326 ATATTTATTGAGCACCTACTAGG + Intergenic
911511846 1:98816694-98816716 CCATTAAACAAACACTTACTAGG - Intergenic
911551144 1:99282481-99282503 ATATTTATTAAATACCTAGTAGG - Intronic
912437347 1:109671107-109671129 GCATTTATTAGACTCCAACTGGG - Intronic
913492533 1:119394482-119394504 CTATTTCTTAAACTCCTACTAGG - Intergenic
913528849 1:119718726-119718748 CCATTTATTGAGCACCTGCTGGG - Intronic
913654052 1:120944737-120944759 GCATTTATTGGGCACCTACTAGG + Intergenic
914267398 1:146049793-146049815 GCATTTATTGGGCACCTACTAGG - Intergenic
914519743 1:148404832-148404854 GCATTTATTGGGCACCTACTAGG + Intergenic
914644249 1:149638901-149638923 GCATTTATTGGGCACCTACTAGG + Intergenic
915568551 1:156730914-156730936 ACACTTATTTAACACCTTCTCGG - Intronic
915569912 1:156739048-156739070 GTATTTGTTAAGCACCTACTAGG - Intronic
915678453 1:157554496-157554518 CCAGTTATTAAAAATCTACTAGG - Intergenic
915736237 1:158087382-158087404 CAATTTATTACACACCTACCAGG - Intronic
916260915 1:162841199-162841221 GCATTTATGAAGCACCCACTAGG - Intronic
916346348 1:163796035-163796057 TCATTTATTATCCACCTCCTAGG - Intergenic
916426509 1:164686167-164686189 TCATTTAGTGAGCACCTACTGGG - Intronic
916527201 1:165621794-165621816 TAATTTATTGAGCACCTACTAGG - Intergenic
916653610 1:166852927-166852949 CAATTTATTCAACACCAACGAGG + Exonic
916752666 1:167737609-167737631 TCATTCAATAAACATCTACTGGG - Intronic
917005859 1:170416594-170416616 GTATTTATTGAGCACCTACTAGG + Intergenic
917139105 1:171816880-171816902 TCATTTATTGAGCACATACTAGG - Intergenic
917215841 1:172677162-172677184 ACATTTGTTAAGCACTTACTAGG + Intergenic
917630584 1:176887645-176887667 CCACTCATTGAACACTTACTGGG - Intronic
917655212 1:177119267-177119289 ACATTTATTTAGCACCTACTAGG - Intronic
917674797 1:177308612-177308634 ACATTTATAGAACACATACTAGG + Intergenic
918132216 1:181639386-181639408 CCACTTGTTAAGCATCTACTCGG - Intronic
918417006 1:184320415-184320437 ATATTTATTAAATACCTACGAGG - Intergenic
918575678 1:186056499-186056521 CCATTTATTAATCAGCACCTAGG - Intronic
918987887 1:191657230-191657252 ACGTTTATTAAGCATCTACTAGG - Intergenic
919459530 1:197859855-197859877 ACATTTATTAAATGCCTATTAGG - Intergenic
919505189 1:198389475-198389497 TAATTTATTAAGCATCTACTGGG - Intergenic
919575248 1:199300485-199300507 ATATTTATTAAACACCTATGAGG + Intergenic
919632214 1:199970507-199970529 CCATTTACTGAAAGCCTACTAGG + Intergenic
919781130 1:201221865-201221887 ACATTTATTGAGCACCTACTAGG + Intronic
919817981 1:201453792-201453814 CCATGTTTTAAAGGCCTACTTGG - Intergenic
920565092 1:206966795-206966817 TTATTTATTAAGCATCTACTTGG + Intronic
920797336 1:209152529-209152551 ACATTTACTGAGCACCTACTAGG - Intergenic
920929494 1:210373657-210373679 ACGTTTATTAAACACTTACTAGG + Intronic
921611485 1:217217201-217217223 TCATTTATTACACACCTATTGGG + Intergenic
921744166 1:218718983-218719005 ACATTTATTGCACATCTACTGGG + Intergenic
922312948 1:224413513-224413535 ACATTTATTAAGCAATTACTAGG + Intronic
922353080 1:224750776-224750798 ACATTTATAAATCACCTTCTAGG + Intergenic
922973857 1:229767174-229767196 CCATTTATTAAATAGCTATTTGG + Intergenic
923824569 1:237485703-237485725 ATATTTATTAAGCACCTACCAGG - Intronic
923880287 1:238096398-238096420 ACATTTATTTAAAGCCTACTAGG - Intergenic
924124986 1:240840830-240840852 ACATTCATTGAGCACCTACTAGG - Intronic
924340089 1:243021312-243021334 CCATTTATCAAATGCCTACATGG + Intergenic
924368886 1:243325818-243325840 ATATTTATTGAGCACCTACTAGG - Intronic
924607277 1:245545410-245545432 ATATTTATTAAGCACCTACTAGG + Intronic
1064709064 10:18104601-18104623 CCATTTATTCAACACTTATGGGG + Intergenic
1065465555 10:26017053-26017075 CCATTTATTGACCACCTCCCAGG - Intronic
1066583300 10:36904002-36904024 CCATTTATTAAAAAATCACTGGG - Intergenic
1067332067 10:45331652-45331674 CAAGTTCTTAAACACCTACAAGG - Intergenic
1068236780 10:54245334-54245356 ACATTTATTACACATATACTCGG - Intronic
1068344208 10:55750309-55750331 TCATTTATTATACACTTACATGG + Intergenic
1068569111 10:58608658-58608680 CCATTTATTAAATGCTTACAGGG + Intronic
1068610665 10:59056650-59056672 ACATTTATTGAACATTTACTTGG - Intergenic
1069333462 10:67320667-67320689 ACATTTATTGAATACCTACCAGG - Intronic
1069890209 10:71647870-71647892 ACATTTATTGAGCACCGACTGGG - Intronic
1070383479 10:75902569-75902591 TCATTTATTCAACACTCACTTGG + Intronic
1070836147 10:79448096-79448118 ATATTTATTAGTCACCTACTGGG - Intergenic
1071009335 10:80919579-80919601 CTATTCATTAAACACAGACTAGG - Intergenic
1071423298 10:85523587-85523609 ACATTTACTAAATTCCTACTTGG - Intergenic
1072198901 10:93141163-93141185 TCATTTATTGAACACTTATTGGG - Intergenic
1072502415 10:96031058-96031080 GCATTTACTAAATACTTACTAGG - Intronic
1072639036 10:97196914-97196936 GCATTTATTGAGCACCTACTAGG - Intronic
1073086654 10:100895307-100895329 GCATTTATTTCACACCTACTTGG - Intergenic
1073792920 10:106957854-106957876 ACATTTATTAAACATTTATTAGG + Intronic
1073915282 10:108396354-108396376 CCATTTATTTTACACAGACTAGG - Intergenic
1074370370 10:112895811-112895833 ACATTTATTGAGCACCTACAAGG + Intergenic
1074427858 10:113368102-113368124 ATGTTTATTAAACACTTACTTGG + Intergenic
1074821742 10:117184753-117184775 CCACTTATTGAACACATACTGGG - Intergenic
1075102497 10:119516301-119516323 CCAGTTATTAAGCGCCCACTGGG + Intronic
1075905219 10:126075381-126075403 GTATTTATTCAACACCGACTAGG + Intronic
1076558659 10:131346740-131346762 CTGCTCATTAAACACCTACTGGG + Intergenic
1077922663 11:6653487-6653509 TCATTTAACAAACACATACTAGG - Intronic
1078025692 11:7693323-7693345 ACATTTATTAAACCCTTACTGGG + Intronic
1078107227 11:8365969-8365991 CCATTTATTCAACATCCATTAGG + Intergenic
1078358790 11:10652513-10652535 CCACTTACTGAGCACCTACTGGG + Intronic
1078516685 11:12028533-12028555 CTATTTATTCCACATCTACTGGG - Intergenic
1078858672 11:15227428-15227450 CCATTTATTAAGAACTTAATAGG - Intronic
1079024390 11:16934503-16934525 CCATTTTTTAAAAAGCGACTTGG - Intronic
1079362858 11:19783891-19783913 ACATTTATGAAACATCTTCTAGG + Intronic
1079372543 11:19863872-19863894 CTATTTACTCAGCACCTACTGGG - Intronic
1080127390 11:28752925-28752947 CCATTTACAGAGCACCTACTGGG - Intergenic
1080248352 11:30204673-30204695 CCATTTTTTGAGCACCTGCTAGG - Intergenic
1080429857 11:32188415-32188437 CTATTTAATAAACAGGTACTCGG + Intergenic
1080443601 11:32317321-32317343 GCATTTATTGAGCACCTACTAGG - Intergenic
1080828233 11:35866171-35866193 CCATTTATTTAGCACCTACTAGG - Intergenic
1081301229 11:41454472-41454494 ATATTTATTAAGCACCTACCAGG - Intronic
1081885782 11:46494879-46494901 CCATTTATTAAGTATCTGCTAGG + Intronic
1081936569 11:46908233-46908255 TCATTTATTAAATACTTACCAGG + Intronic
1082010392 11:47446525-47446547 AGATTTATTAAGCATCTACTGGG + Intronic
1082797054 11:57385809-57385831 CCATTTATTAAGCATTTACTAGG - Intergenic
1082805336 11:57445650-57445672 TAATTTATGAAACAACTACTGGG - Intergenic
1082884648 11:58069295-58069317 CCACATATGAAACACCCACTGGG - Intronic
1085800408 11:79584337-79584359 CCATTCATTAAACATTTAGTGGG - Intergenic
1085809610 11:79668126-79668148 CAATTTATTAAGGAACTACTGGG - Intergenic
1085857927 11:80196789-80196811 CCAATTCTCAAACACCAACTAGG - Intergenic
1086111414 11:83202958-83202980 ACATTTATTGAACATCTGCTAGG - Intronic
1086226944 11:84523210-84523232 CCATTTACTGAGCAACTACTAGG + Intronic
1086229169 11:84547813-84547835 GCATTTATTAAGCACCTACTGGG - Intronic
1086254500 11:84859137-84859159 ACATTTATTTATTACCTACTAGG - Intronic
1086295064 11:85357065-85357087 CAATTTATTGAGCACCTACTTGG - Intronic
1086579611 11:88384164-88384186 TCATTTAATATACACATACTTGG - Intergenic
1086596704 11:88580838-88580860 ACATTTAATAAACACCTGTTAGG + Intronic
1087121574 11:94580713-94580735 GCATTTATTGAGCACTTACTAGG + Intronic
1087304243 11:96470450-96470472 CCATTTATTGAATACTTCCTTGG + Intronic
1087450307 11:98312504-98312526 CCATTTAATAAGCAGCTACCTGG - Intergenic
1088535947 11:110861466-110861488 TAATTTATTAAGCATCTACTTGG + Intergenic
1088620125 11:111673282-111673304 ACATTTATTAAATAGCTACATGG + Intronic
1088695570 11:112362964-112362986 GTATTTATTAAGCCCCTACTGGG - Intergenic
1088704969 11:112453881-112453903 GCATTTATTAACCACCTACAGGG - Intergenic
1088770149 11:113026759-113026781 TCATTTATTAAGCACCTGCTAGG + Intronic
1089083414 11:115796726-115796748 CCATTTGTTAAATATTTACTGGG + Intergenic
1089174937 11:116541532-116541554 ACATATATTGAACACCTGCTAGG + Intergenic
1089250448 11:117156288-117156310 CCATTTATCAAGTACCTAGTGGG + Intronic
1089957263 11:122583138-122583160 CCATTTATTAAATAGGTGCTGGG + Intergenic
1090010193 11:123039300-123039322 ACATTTATTGAACCCCTAATAGG - Intergenic
1090032797 11:123221808-123221830 TTATTTATTAAGCACATACTGGG + Intergenic
1090105147 11:123845758-123845780 ACATTTAGTGAGCACCTACTAGG - Intergenic
1090427361 11:126617627-126617649 CCATTTATTGAGTTCCTACTAGG + Intronic
1090924552 11:131237882-131237904 CTGTTTATTGAGCACCTACTCGG - Intergenic
1091033967 11:132216699-132216721 ATATTTATTAAACACTTCCTAGG - Intronic
1091335262 11:134761845-134761867 CCACTTATTGATCATCTACTGGG - Intergenic
1092104416 12:5911242-5911264 ACATTTACTGAGCACCTACTAGG - Intronic
1092551381 12:9505111-9505133 CAATTTATTGAGCACTTACTAGG + Intergenic
1092977203 12:13756849-13756871 CAATCTATTAAATACCAACTTGG + Intronic
1093071948 12:14715018-14715040 CCATTCATTGAGCACCTAGTGGG + Intergenic
1093145742 12:15564426-15564448 GCATTTATTGACCACCCACTAGG + Intronic
1093515776 12:19985191-19985213 CCATTTGTTAAGCATCTATTTGG - Intergenic
1093833286 12:23793283-23793305 GCATTTATTAAGTGCCTACTCGG + Intronic
1093966039 12:25327001-25327023 CTATTTATTGAACACCTATTAGG + Intergenic
1093993469 12:25615956-25615978 ACATTTATTAAATGCCTACCAGG + Intronic
1094042971 12:26136527-26136549 TCATTTATTGCTCACCTACTAGG - Intronic
1094095821 12:26703396-26703418 ACATTTATTGAATGCCTACTAGG - Intronic
1094520427 12:31181223-31181245 CAATTTATTGAGCACTTACTAGG - Intergenic
1095490530 12:42728871-42728893 ACATTTCTTAACCACCTGCTGGG - Intergenic
1095962745 12:47845636-47845658 CAATTTATTGAGCACCTATTAGG - Intronic
1096548112 12:52355155-52355177 GTATTTGTTAAACACCTGCTAGG + Intergenic
1096654512 12:53080063-53080085 ATATTTATTGAACACCTACTAGG + Intergenic
1097014887 12:55978617-55978639 GCATTTAATGAGCACCTACTAGG + Intronic
1097933354 12:65215450-65215472 ACATTAAATAAACATCTACTAGG - Intronic
1098005960 12:65997235-65997257 ACATTTATTAAATGCTTACTTGG + Intergenic
1099041680 12:77662571-77662593 GCATTTATTAAACAAGTACTAGG - Intergenic
1099124433 12:78734867-78734889 TCTTTTATTTAACACCTACCAGG + Intergenic
1099464755 12:82970281-82970303 CCCGTTATAAAACACTTACTAGG - Intronic
1099571060 12:84319405-84319427 TAATTTATTCAGCACCTACTGGG + Intergenic
1100227366 12:92572825-92572847 GCATTTATTGAACAACTACTAGG - Intergenic
1100378480 12:94039850-94039872 GCATTTATTAAAAACCCACTAGG + Intergenic
1100394817 12:94175721-94175743 TCATTTAATAAATATCTACTGGG + Intronic
1100812976 12:98358228-98358250 CTATTTACTGAGCACCTACTAGG - Intergenic
1101055436 12:100907576-100907598 TCATTTATTAAGAACCTACTAGG - Intronic
1101148272 12:101862229-101862251 CTTTTTCTTAAAAACCTACTTGG - Intergenic
1101248973 12:102913173-102913195 CCTTTTATTGAGCAACTACTAGG + Intronic
1101277783 12:103221377-103221399 TCATTTATTGAATATCTACTGGG + Intergenic
1101610343 12:106285395-106285417 ATATTTATTGAGCACCTACTAGG - Intronic
1101749947 12:107575360-107575382 CCATTTATTGAGCACTTTCTCGG + Intronic
1101873276 12:108582524-108582546 ACATTTATTGAGCACCTACTGGG + Intergenic
1102426934 12:112851127-112851149 CAATTTATTAAGCACTTACTAGG + Intronic
1103050509 12:117775359-117775381 TGTTTTATTAAACACCCACTAGG - Intronic
1103178349 12:118884983-118885005 CCATTTACTGAGCACTTACTAGG + Intergenic
1103249554 12:119487789-119487811 CTTTGTATTAAACACCTACAAGG - Intronic
1103911369 12:124354394-124354416 CCCTTTATTCAAAACCTGCTGGG - Intronic
1104643593 12:130482308-130482330 GGATTTATTGAGCACCTACTAGG + Intronic
1104665366 12:130643692-130643714 ACATTTATTGAACACCTGCGTGG + Intronic
1105249374 13:18683937-18683959 ACATTTATCAAACACCTAGTAGG + Intergenic
1105688807 13:22814949-22814971 CCATTTCTTAACCACCTGTTAGG + Intergenic
1105794769 13:23840334-23840356 ACATCTGTTAAGCACCTACTTGG + Intronic
1106038963 13:26071502-26071524 ACATTTATTGAGCACTTACTAGG + Intergenic
1107371469 13:39754690-39754712 ACATTTCTTAAGTACCTACTAGG + Intronic
1107409721 13:40147455-40147477 ATATTTATTAAGCACTTACTAGG - Intergenic
1108468110 13:50739353-50739375 ACATTTATTGAATGCCTACTGGG - Intronic
1108561287 13:51646593-51646615 ACATTTATCAAACACCTACTAGG - Intronic
1108757992 13:53527747-53527769 CCATGTATTCAGCGCCTACTAGG - Intergenic
1109173799 13:59129748-59129770 ACACTTATTAAACACCCACTAGG + Intergenic
1109302371 13:60602177-60602199 TCCTTTTTTGAACACCTACTAGG - Intergenic
1109827848 13:67746186-67746208 ACATTTCTTAACCTCCTACTTGG - Intergenic
1110292129 13:73819533-73819555 ATATTTATTGAACACCTACGAGG + Intronic
1110357878 13:74589365-74589387 TCATTTATTCAACAAATACTGGG + Intergenic
1110493783 13:76140617-76140639 CCTTTTATTAAAAATGTACTTGG + Intergenic
1111159120 13:84370150-84370172 CATTTTAATAAACACCTAGTAGG - Intergenic
1111710266 13:91803024-91803046 CTATTTTTAAAACATCTACTTGG - Intronic
1111730015 13:92062857-92062879 ACATTTATTGAGCACCTAGTGGG + Intronic
1112241454 13:97685765-97685787 CCATTGATTAAGCATCTGCTTGG + Intergenic
1112304741 13:98263682-98263704 CCTACTATTAAACATCTACTGGG - Intronic
1112716487 13:102192006-102192028 CCATTTATTCTAGACCTACAGGG + Intronic
1112897441 13:104317393-104317415 ATATTTATTAATCACTTACTAGG + Intergenic
1112920503 13:104605674-104605696 ATATTTATTAAGCACCTATTAGG + Intergenic
1113598405 13:111550455-111550477 ACATTTATTAAACATTCACTAGG + Intergenic
1114616347 14:24070531-24070553 CCATTTATTGAGCATCTCCTGGG - Intergenic
1116498894 14:45596380-45596402 CCATTTATTGAATGCCTATTAGG + Intergenic
1117054957 14:51902458-51902480 ACATTTATCAAGCTCCTACTAGG - Intronic
1117502741 14:56370115-56370137 CCATTTATGACAAACCCACTGGG - Intergenic
1117712712 14:58549007-58549029 CCATTTATTGAGCACTTACATGG - Intronic
1117900710 14:60529595-60529617 CCATTCATTCACCATCTACTGGG + Intergenic
1118190210 14:63573183-63573205 CCATTGAATAAATACCTATTTGG + Intergenic
1119112850 14:71991078-71991100 ACATTTATTTATCACCTACTTGG - Intronic
1119220492 14:72902569-72902591 CCAATTATTAACCATCTGCTAGG - Intergenic
1119314272 14:73678372-73678394 TCATTTATTAACCACATAGTAGG + Intronic
1119937887 14:78609713-78609735 TAATTTATTGAACACTTACTAGG - Intronic
1120527538 14:85594540-85594562 CTGTTTATTGAGCACCTACTGGG - Intronic
1120615758 14:86701899-86701921 TCATTTTCTAAGCACCTACTTGG + Intergenic
1120625668 14:86823041-86823063 TTATTTATTAAGCAGCTACTAGG - Intergenic
1120927966 14:89816971-89816993 ACATTTATTGAGTACCTACTTGG + Intronic
1121380903 14:93465146-93465168 CAATTTATTGAGTACCTACTAGG + Intronic
1121598128 14:95181460-95181482 ATATTTATTACACACCTACTTGG - Intergenic
1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG + Intronic
1121863332 14:97339598-97339620 CCATTTAAATATCACCTACTTGG - Intergenic
1121926927 14:97935438-97935460 TAATTTATTGAACATCTACTAGG - Intronic
1122164059 14:99807875-99807897 ACATTTATGAGATACCTACTAGG - Intronic
1122198023 14:100104109-100104131 CTATTTACCAAACACTTACTTGG - Intronic
1122289356 14:100671687-100671709 CATTTTATTGAGCACCTACTAGG + Intergenic
1122699528 14:103578566-103578588 GTATTTATGAAACACCCACTCGG + Intronic
1124801044 15:32833090-32833112 GCATTTAATAAACAGCTGCTGGG - Intronic
1125114846 15:36078472-36078494 CCATTTATTAAGCATTTGCTTGG - Intergenic
1125165248 15:36696526-36696548 ACATTTATTAAGCACTTAATAGG - Intronic
1125242757 15:37595250-37595272 ACATTTCTTAAATACCTGCTGGG - Intergenic
1125313139 15:38402421-38402443 CCTTTTATTTAGCACCTCCTAGG - Intergenic
1125396229 15:39251145-39251167 CCATTTATTAGGCACCTACCAGG - Intronic
1125672656 15:41485184-41485206 GCATTTATTGGACCCCTACTGGG - Intergenic
1126062594 15:44797889-44797911 TCATTTATTAAGCACATACAAGG - Intergenic
1126721203 15:51582106-51582128 CCATTTATTAAAAACCTACTGGG + Intronic
1127334397 15:57969278-57969300 ACATTTATTGAACATCTACTAGG - Intronic
1127608216 15:60611633-60611655 GTATTTATTGAGCACCTACTAGG - Intronic
1127847163 15:62880815-62880837 ACATTTATTAAGCATCTACCAGG + Intergenic
1127939266 15:63677292-63677314 ACATTTATTTAACACAAACTGGG - Intronic
1128319222 15:66681236-66681258 GCATTTATTGAGCACTTACTAGG - Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1128621343 15:69152960-69152982 CCATCTGTTGACCACCTACTTGG + Intergenic
1128794658 15:70456659-70456681 CTATTTATCATAAACCTACTAGG + Intergenic
1131334829 15:91538707-91538729 CTATGAATTAAGCACCTACTAGG + Intergenic
1131849799 15:96526556-96526578 CCGTTTAATAAATACTTACTGGG - Intergenic
1133456940 16:5950706-5950728 ACATTTATCAGGCACCTACTGGG + Intergenic
1133612991 16:7450684-7450706 GCATCTATTAATCACCTACTGGG + Intronic
1133626852 16:7578158-7578180 CCATTTATTGAATACATACCAGG + Intronic
1134386348 16:13776968-13776990 CCATTTACTGAGCATCTACTTGG + Intergenic
1134838072 16:17378608-17378630 CCATTTATGAAGCACGTATTAGG + Intronic
1134850868 16:17477690-17477712 ACATTTATTGAGCACTTACTAGG + Intergenic
1134863442 16:17582768-17582790 TCATTTACTGAACACCTAGTAGG + Intergenic
1134910783 16:18024322-18024344 ACATTTACTGCACACCTACTAGG - Intergenic
1135607084 16:23834668-23834690 TTTATTATTAAACACCTACTGGG + Intergenic
1135855688 16:26007974-26007996 GCATTTATTAAGCACCCACTAGG + Intronic
1136345749 16:29674616-29674638 CCATTCAGTAAACATATACTAGG - Intronic
1136688152 16:32008191-32008213 ACATTTACTGAGCACCTACTAGG + Intergenic
1136788756 16:32951746-32951768 ACATTTACTGAGCACCTACTAGG + Intergenic
1136881057 16:33902188-33902210 ACATTTACTGAGCACCTACTAGG - Intergenic
1137373436 16:47930000-47930022 CCATTTATTAAATATATAGTTGG + Intergenic
1138003660 16:53309544-53309566 ATATTTATTAAATACCTAATTGG + Intronic
1138054892 16:53822414-53822436 CCACTTGTTAAACACTTTCTAGG - Intronic
1138302615 16:55945145-55945167 TCATTTATTGAGCACCTATTAGG + Intronic
1138302626 16:55945240-55945262 TCATTTATTGAGCACCTATTAGG + Intronic
1139410722 16:66758222-66758244 ACATTTATTAAGCACCTGCTAGG - Intronic
1139518686 16:67467069-67467091 GCTTTTATTAGACACATACTAGG - Intronic
1139570407 16:67808153-67808175 ACATTCATTCAACACTTACTGGG - Intronic
1139917302 16:70436730-70436752 TCATTTACTGAACACCCACTAGG + Intronic
1141049477 16:80747498-80747520 GCATTTATTAAGCACGTAATAGG - Intronic
1141084569 16:81083567-81083589 CCATTTGTTAAAGACATACCTGG - Intronic
1203090953 16_KI270728v1_random:1213235-1213257 ACATTTACTGAGCACCTACTAGG + Intergenic
1143004309 17:3818131-3818153 GCGTTTATTAAACTCCTACAAGG + Intronic
1143652847 17:8274821-8274843 ATATTTATTGAGCACCTACTAGG - Intergenic
1144051132 17:11497992-11498014 GTATTTATTAAGCACTTACTGGG - Intronic
1144386088 17:14750549-14750571 CCATTTGTTGAATACCTGCTAGG - Intergenic
1146127812 17:30242627-30242649 CCATTTATTGAGCCTCTACTAGG + Intergenic
1146780756 17:35669582-35669604 CCAGTTATGAAGCACCTACCAGG + Intronic
1147149143 17:38503894-38503916 ACATTTACTGAGCACCTACTAGG + Intronic
1147221904 17:38939406-38939428 ACATTTATTGAGCACCTGCTAGG + Intronic
1147401714 17:40184286-40184308 CCATTTCTTGGACACCTACCAGG + Exonic
1147650851 17:42061165-42061187 ATATTTATTGACCACCTACTAGG - Intronic
1148325930 17:46783523-46783545 GCATTTCTTGAGCACCTACTAGG + Intronic
1148383137 17:47214812-47214834 CCTTTTATTAAATATATACTTGG + Intronic
1149447238 17:56722897-56722919 ACATTTATTAAGCACTCACTGGG + Intergenic
1149502486 17:57164647-57164669 CTATGTATTAAGCATCTACTGGG + Intergenic
1150064547 17:62098037-62098059 ACATTTATTACACATCCACTAGG - Intergenic
1150718906 17:67597697-67597719 ACATTTGTTAAACATCTATTCGG + Intronic
1150909288 17:69371419-69371441 ACATTTATTAAATACTGACTAGG + Intergenic
1150923909 17:69512817-69512839 ATATTTATTAAGCACCTATTTGG - Intronic
1151373480 17:73665928-73665950 GGATTTATGAAACACCTACTAGG - Intergenic
1151763472 17:76120620-76120642 ACATTTCTTGAGCACCTACTAGG - Intronic
1152189418 17:78879461-78879483 ACGTTTACTGAACACCTACTGGG + Intronic
1152264525 17:79286648-79286670 CCTTTTGTTAACCCCCTACTGGG + Intronic
1153298200 18:3568504-3568526 ACATTTCTTAAACACATAGTAGG - Intronic
1154055568 18:11010164-11010186 CCATGTACCAAACACCTACTAGG + Intronic
1154160660 18:11978956-11978978 ATATTTATTAAACACCTATTGGG + Intergenic
1154439515 18:14375283-14375305 ACATTTATCAAACACCTAGTAGG - Intergenic
1155489985 18:26391312-26391334 CCATTTTTGAAATACCTTCTTGG - Exonic
1155545724 18:26912744-26912766 ACATTTATTCAATACTTACTGGG - Exonic
1156102916 18:33620077-33620099 CCATTTATTATACTCCCACTGGG + Intronic
1156365993 18:36427741-36427763 CCATTTCATAAACACTGACTGGG - Intronic
1156547046 18:37973975-37973997 ATATTTATTAATCACCTTCTAGG + Intergenic
1156945400 18:42823421-42823443 GCATTTATCAAATACCTACTTGG + Intronic
1157421109 18:47548270-47548292 GTTTTTTTTAAACACCTACTTGG + Intergenic
1158565821 18:58553467-58553489 ACATTTATTAAGCACTTACTTGG - Intronic
1158801335 18:60913677-60913699 ACATTCATTGAACATCTACTAGG - Intergenic
1159465396 18:68776283-68776305 CTATTTATTTAAAAACTACTTGG + Intronic
1159571881 18:70123858-70123880 ACATTTATTGATCACCTACTAGG - Intronic
1159744873 18:72220436-72220458 CCATTTATCTATCACCTGCTAGG - Intergenic
1160140773 18:76320292-76320314 GAATTTATTGAACACATACTGGG - Intergenic
1160334223 18:78023152-78023174 CAATTTACTAAACAACTACTTGG + Intergenic
1160821367 19:1060125-1060147 CCACTTATTGGCCACCTACTAGG + Intronic
1161255464 19:3306646-3306668 ACATTTATGAAGCACCTACTGGG + Intergenic
1161527070 19:4762872-4762894 CCATTTATTGAAAACCTACTAGG - Intergenic
1161537706 19:4830547-4830569 GCATTTATTGAGCACCTACTAGG + Intronic
1162331987 19:10035729-10035751 GCATTTGTCAAGCACCTACTAGG - Intergenic
1162411062 19:10505600-10505622 CCATTTATTATTCACTTACATGG - Intergenic
1162413327 19:10519068-10519090 TCATTTATTGAGCACCTACTGGG - Intergenic
1163120493 19:15214375-15214397 ACATTTACTGGACACCTACTTGG + Intergenic
1163448229 19:17360258-17360280 ACAATTATTAGGCACCTACTGGG - Intronic
1164680114 19:30128534-30128556 CCATTCATTAAACACCACCACGG - Intergenic
1166280995 19:41793200-41793222 CCATTTATTAAACCCTTTCTAGG - Intergenic
1166395854 19:42440585-42440607 CCATTTATTAAACCCTTTCTAGG + Intronic
1166651091 19:44575771-44575793 GCATTTATTAAACACATGATGGG + Intergenic
1166705555 19:44906109-44906131 TCATTTATCGAGCACCTACTGGG + Intronic
1166882263 19:45936800-45936822 ACACTTATTAAGCACCTACTGGG + Exonic
1167115198 19:47485091-47485113 TCCTTTATCGAACACCTACTTGG + Intergenic
925470629 2:4157467-4157489 ACATTTATTAAGTACCTACTAGG - Intergenic
925833184 2:7916442-7916464 CCAATTATAAAACACCTCTTAGG - Intergenic
925896095 2:8473434-8473456 CCATTTATGGAATACCTACTTGG + Intergenic
926025217 2:9537193-9537215 CCATTTATTGAACACCTACTTGG + Intronic
926067318 2:9853428-9853450 CCATTTATTCGTCATCTACTAGG - Intronic
926342617 2:11916863-11916885 ACATTTATTTAACATCTACTGGG + Intergenic
926380443 2:12281934-12281956 ATATTTAGTAAATACCTACTAGG + Intergenic
926585102 2:14676864-14676886 TCATTTATTATATAACTACTAGG - Intergenic
926586703 2:14694058-14694080 ATATTTACTAAACACCTACCAGG - Intergenic
926859878 2:17298380-17298402 CCATTTATTAATCATCTCATAGG + Intergenic
926997156 2:18748396-18748418 CTATATATTAAAAACATACTCGG + Intergenic
927037164 2:19189996-19190018 ACATTTATTGAACACTTACCAGG - Intergenic
927345075 2:22028579-22028601 ATATTTATTAATCATCTACTAGG + Intergenic
928108817 2:28490196-28490218 CCATTTGTTGAGCACCTAGTAGG - Intronic
928380428 2:30813146-30813168 AAATTTATTGAGCACCTACTAGG - Intronic
929338844 2:40787233-40787255 CCATTATTTAACCATCTACTAGG - Intergenic
930164174 2:48187508-48187530 ATATTTATTGAGCACCTACTGGG - Intergenic
930171661 2:48257928-48257950 TCATTTATTTAACATTTACTGGG + Intergenic
930186466 2:48417013-48417035 TCATTTATTAGATGCCTACTGGG - Intergenic
930307415 2:49692970-49692992 TCATTTATTAAAAATCTACTTGG - Intergenic
930801612 2:55448735-55448757 CCATTTAATAAATATCTTCTGGG + Intergenic
930956890 2:57213641-57213663 CCATTTATGAAGCACATGCTGGG - Intergenic
932001388 2:67888497-67888519 GCATTTATTGAGCACCTTCTAGG + Intergenic
932557816 2:72841107-72841129 CCATTTATGAAGCACCTGCTGGG + Intergenic
932621548 2:73267505-73267527 ACATTTATTGAACACCCTCTAGG + Intronic
932859889 2:75279262-75279284 ACAATTATTCAATACCTACTTGG - Intergenic
936920254 2:117681430-117681452 CCATTTATAAAACACAGACAGGG - Intergenic
937619790 2:123972321-123972343 ATATTTATTAAATACCTAATAGG - Intergenic
937665472 2:124482573-124482595 CCATTTCTGAAACACCTCATTGG - Intronic
937724471 2:125145626-125145648 GCATTTATTAAACAATCACTTGG + Intergenic
938584323 2:132674236-132674258 CCATTTATTAAGCATCCACTAGG + Intronic
938609672 2:132934703-132934725 ACATTTATGAAAGACCTATTTGG + Intronic
938638967 2:133259881-133259903 ATATTTATTAAACACTTACTAGG + Intronic
938705276 2:133918989-133919011 ACATTTAGTAAGCACCCACTAGG + Intergenic
938705279 2:133919072-133919094 ACATTTAGTAAGCACCTACTAGG + Intergenic
938705281 2:133919155-133919177 ACATTTAGTAAGCACCCACTAGG + Intergenic
939103499 2:137923401-137923423 ACATTTATCAAACAGCTAGTAGG + Intergenic
939269467 2:139918675-139918697 CCATTTATTAAGTATCTACTTGG + Intergenic
939279996 2:140051111-140051133 ATATTTGTTAAAAACCTACTTGG - Intergenic
939764685 2:146232044-146232066 ACATTTATTGGGCACCTACTGGG + Intergenic
940326690 2:152433090-152433112 CCATTTATTCAGCGCCTATTAGG - Intronic
940425189 2:153523971-153523993 CCCTGTATTAAACATTTACTGGG + Intergenic
940826001 2:158413375-158413397 CATTTTAATAAAAACCTACTGGG + Intronic
941658145 2:168166549-168166571 ACATTTAGTGAGCACCTACTGGG + Intronic
941782797 2:169463006-169463028 ACATTTATGAAGCATCTACTAGG + Intergenic
942242638 2:173977241-173977263 TAATTTATTAAAGTCCTACTAGG - Intergenic
942530285 2:176902660-176902682 TCATTTATTGAGCACCTGCTGGG - Intergenic
942928993 2:181466888-181466910 TTATTTATTGACCACCTACTAGG + Intronic
943363316 2:186946596-186946618 ACAGTTATTAAAAAGCTACTGGG + Intergenic
944047235 2:195427094-195427116 CCATTTAAAAAACACACACTAGG - Intergenic
944917242 2:204373614-204373636 ACATTTATTAAACACATACCTGG - Intergenic
944985263 2:205168980-205169002 CCATTTATCGAACACCTATTAGG - Intronic
945012379 2:205479316-205479338 TCATTTATTGAACACATCCTAGG + Intronic
945407407 2:209466515-209466537 ACATTTATCAAGGACCTACTAGG + Intronic
945954699 2:216075764-216075786 ACATTTATTCAGCACCTTCTTGG + Intronic
946299976 2:218816992-218817014 ACATTTACTAAGCACCTCCTAGG - Intergenic
946549096 2:220780681-220780703 GCATTTATTAAGCCCCTGCTAGG + Intergenic
946743981 2:222827798-222827820 CCATTTATTGAATGCCTACTAGG + Intergenic
946749159 2:222875896-222875918 ACATTTATTGAACATATACTAGG + Intronic
946999342 2:225436020-225436042 TTATTTATTGATCACCTACTAGG + Intronic
947262949 2:228245005-228245027 CCATCTTTTAAACAACTACTAGG - Intergenic
947308383 2:228773345-228773367 ACAGTTATTAAGCACCTAGTAGG + Intergenic
948228231 2:236329688-236329710 AAATTTATTAAACATCTACTTGG + Intronic
1168908479 20:1426119-1426141 ACATGTATTAAGCACCTGCTAGG - Intergenic
1168950760 20:1800040-1800062 CCAATTTTTAAAAATCTACTAGG + Intergenic
1169581781 20:7031604-7031626 ACATTTATTGGACACCTACTGGG - Intergenic
1169607224 20:7335599-7335621 AAATTTATTAAACACATTCTTGG + Intergenic
1170513486 20:17103884-17103906 CTACTTATTGAACACCTCCTAGG + Intergenic
1170823639 20:19775098-19775120 CCAGATATTTAACACCTCCTTGG - Intergenic
1170879115 20:20278861-20278883 ATATTTATTGAACACCTGCTAGG + Intronic
1171500139 20:25586613-25586635 ATATTTATCGAACACCTACTAGG + Intergenic
1172633189 20:36392706-36392728 ATATTTATTAAGCACCTACTAGG + Intronic
1172841802 20:37906380-37906402 CTGTTTATTGAGCACCTACTAGG - Intronic
1173245817 20:41336740-41336762 ACATTTATTGAGCACCTACTGGG - Intergenic
1173328355 20:42053786-42053808 GCATTTATTTAGCACCTATTTGG + Intergenic
1173512684 20:43642726-43642748 ATATTTATTAAGCATCTACTAGG + Intronic
1173840992 20:46157142-46157164 ACACTTATTAAGCACCTCCTAGG - Intergenic
1174090764 20:48045052-48045074 ACGTTTCTTAAAAACCTACTAGG - Intergenic
1175197988 20:57258911-57258933 CCATTTGTTTTACACCTACTAGG + Intronic
1175225999 20:57444416-57444438 ATATTTGTTAAGCACCTACTAGG + Intergenic
1175265275 20:57699324-57699346 CCATTTATTGAGCATCTACTAGG + Intronic
1175449893 20:59054918-59054940 ACATTTGTTAAGCACCTATTAGG - Intergenic
1175478324 20:59292827-59292849 CTACTTATTAAGCACCTACTGGG - Intergenic
1175590982 20:60191814-60191836 CCATTTATTGAACACTTATTAGG + Intergenic
1175742416 20:61429496-61429518 CCATTTATTCAACACACACCAGG - Intronic
1176834401 21:13779503-13779525 ACATTTATCAAACACCTAGTAGG + Intergenic
1177078438 21:16607998-16608020 ATATTTATTAAAGCCCTACTAGG - Intergenic
1177249005 21:18568354-18568376 CAATCTATTAAACAGCTTCTAGG + Intergenic
1178304028 21:31475470-31475492 ACATTTATTTAATACCTACATGG - Intronic
1178812385 21:35895951-35895973 CCACTTATTAAACATCTACCCGG - Intronic
1179361823 21:40716750-40716772 ATATTTATTGAGCACCTACTAGG + Intronic
1180694101 22:17740946-17740968 GCATCTATTGAACACTTACTGGG - Intronic
1181266043 22:21631539-21631561 ACATTTATTGAGCACCTACTTGG + Intergenic
1181687502 22:24539674-24539696 ACATTTACTGAACATCTACTAGG + Intergenic
1181847089 22:25719603-25719625 GCATTTATTAAGTGCCTACTGGG + Intronic
1181884647 22:26010630-26010652 CTGCTTATTAAACACCAACTTGG - Intronic
1181938931 22:26460153-26460175 TCATTTATTGAGCACCTACTAGG - Intronic
1182035377 22:27194432-27194454 TCATTTATTCAGCACCTATTTGG + Intergenic
1182037705 22:27212429-27212451 ACATTTATCAAAAACTTACTGGG - Intergenic
1182046390 22:27277615-27277637 CCATTTATTGAGCACCTACTAGG + Intergenic
1182523138 22:30896326-30896348 TTATTTTTTAAACAACTACTAGG + Intronic
1182540818 22:31040526-31040548 TTATTTATTAAGGACCTACTAGG + Intergenic
1183016035 22:34988022-34988044 ACTTTTATTGAGCACCTACTAGG - Intergenic
1183040688 22:35175606-35175628 CCTTGTATTAATCACCTACTAGG - Intergenic
1183096081 22:35553121-35553143 GCATTTATTAAGCACCTACTGGG + Exonic
1183362182 22:37388410-37388432 ATATTTATTGAGCACCTACTAGG - Intronic
1183808744 22:40236401-40236423 CCATTAATAATACACCAACTTGG - Intronic
1183821252 22:40347349-40347371 CCGTTTAATAAACCCCTACCCGG - Intronic
1184974928 22:48054268-48054290 ATATTTATTAACGACCTACTCGG - Intergenic
1184983878 22:48115794-48115816 GCATTTACTAAGCACCTACGCGG - Intergenic
949564089 3:5229096-5229118 ACATTTATTAAGCACCTACTAGG + Intergenic
949687935 3:6599503-6599525 AAATTTACTAAGCACCTACTAGG + Intergenic
949730539 3:7107289-7107311 ACATTTATTAGGCTCCTACTAGG - Intronic
949801861 3:7912946-7912968 ACATTTATTGAACACATCCTTGG - Intergenic
950171601 3:10842710-10842732 ACATTTACTGAGCACCTACTAGG - Intronic
950173939 3:10858788-10858810 GCACTTATTAAACACCTACTGGG + Intronic
950175057 3:10867473-10867495 CTATTAACTGAACACCTACTGGG - Intronic
950410306 3:12831838-12831860 CCATTCATTAAACACTTCCTGGG + Intronic
950432712 3:12960166-12960188 CCATTTACTGAACACCTACTAGG + Intronic
950839049 3:15949392-15949414 ACATTTATTGAGCACCTGCTGGG + Intergenic
950988091 3:17398580-17398602 TCATTTATTAAGCATCAACTTGG + Intronic
951535696 3:23738495-23738517 CCATTTATTAAACACTGTGTGGG + Intergenic
951599539 3:24358079-24358101 ATATTTATTAAACATCTACCAGG - Intronic
952369371 3:32705915-32705937 CCATTTATTGAATGCATACTGGG + Intronic
952563867 3:34631745-34631767 CCATCTATTAAAGAACAACTTGG + Intergenic
952810626 3:37399365-37399387 GAACTTATTGAACACCTACTGGG - Exonic
952949321 3:38507103-38507125 ATATTTATTGAACACCTATTAGG + Intronic
953720716 3:45352496-45352518 CCATTTATTAAGCACCTGCCTGG + Intergenic
953772971 3:45792844-45792866 CCAGTTGTTAAACATTTACTGGG + Intronic
955678402 3:61473861-61473883 CTATTTATTAAGCATCTCCTAGG + Intergenic
955769338 3:62372959-62372981 CAATTTAATAAGCACCTAGTCGG + Intronic
958427998 3:94001720-94001742 ACATGTATCAAACACCTCCTTGG - Intronic
958624936 3:96612063-96612085 CCAAATATTAATCACCTACCAGG + Intergenic
959411042 3:106021804-106021826 TAATATATTAAACACCAACTGGG + Intergenic
959641916 3:108648317-108648339 CCATTTCTTAAACACTTATGTGG + Intronic
959778225 3:110196760-110196782 ACATTTTTTAAACATCTTCTTGG - Intergenic
959825578 3:110792080-110792102 TCATTTCTTAAACATTTACTTGG + Intergenic
960036588 3:113108531-113108553 ACAATTATTGAGCACCTACTGGG + Intergenic
960135415 3:114099237-114099259 CCATTTACTAAAAACCTTTTTGG + Intergenic
960208213 3:114928936-114928958 ACATTTATTAAGCACTTAGTTGG + Intronic
960523043 3:118677887-118677909 CAATTTATTGAACACTTATTAGG - Intergenic
961211155 3:125127052-125127074 GCATTTATTTAGCACCTACAAGG - Intronic
962024997 3:131538489-131538511 TTATTTATTAACCACCTACATGG + Intronic
962105672 3:132386221-132386243 TCATTTAACAAACACCTACGTGG - Intergenic
962275891 3:134013116-134013138 GCATTTATTGAATATCTACTGGG - Intronic
962932274 3:140049444-140049466 CCATTTATTAAATGCTTATTAGG + Intronic
963773695 3:149416646-149416668 ACATTTACTGAACACCTACTAGG - Intergenic
963841621 3:150113735-150113757 TAAGTTATTAAGCACCTACTTGG + Intergenic
963920517 3:150900552-150900574 GCATTAATTAAACACATCCTGGG - Intronic
964079683 3:152738368-152738390 CCATTTGTTTACCACCTACCAGG - Intergenic
964130343 3:153279968-153279990 ATATTTACTAAACACCTCCTAGG + Intergenic
964327613 3:155564216-155564238 ACATTTATTAAACTTCTAGTGGG - Intronic
964568634 3:158088281-158088303 ATATTTATTAAATACCTACTGGG - Intergenic
964677322 3:159298107-159298129 CCATTCAATAAATACATACTGGG - Intronic
965116273 3:164493297-164493319 ACATTTATTAAGCACTTTCTTGG + Intergenic
965325492 3:167298518-167298540 TCATTTATCAGATACCTACTTGG + Intronic
965983562 3:174723384-174723406 CAATTTATTGAACACCAAGTAGG - Intronic
966075235 3:175927967-175927989 ATATTTATTAAACATCTTCTAGG - Intergenic
966126493 3:176582797-176582819 TCAGTAATTAAAAACCTACTAGG + Intergenic
966292107 3:178371732-178371754 TCATTTATCAAGCACTTACTTGG + Intergenic
966659238 3:182396055-182396077 CCATTTATTAAGCATCTCCCAGG - Intergenic
966787099 3:183631735-183631757 ACACATATTGAACACCTACTAGG + Intergenic
966945628 3:184775313-184775335 ACATTTATTGAACAGCTACTAGG - Intergenic
967101182 3:186217032-186217054 CTATGCATTAAACACCTGCTTGG - Intronic
967122894 3:186399500-186399522 CCACTTCTTAAACCCCTGCTTGG + Intergenic
967299329 3:187997165-187997187 CCATTTATGGAGCACCCACTGGG - Intergenic
967946358 3:194807235-194807257 GCACTTATGAAACACCTTCTGGG - Intergenic
969071483 4:4542622-4542644 CCATTTATTGGCCACTTACTAGG - Intergenic
970109726 4:12624308-12624330 CTATTTATTAAACACCTTACAGG + Intergenic
970139126 4:12960933-12960955 ACATTTATTGAACATCAACTAGG - Intergenic
970353615 4:15230898-15230920 GCATTTATTAAGCATCTAATGGG + Intergenic
970371676 4:15413340-15413362 CCATTTATTTAGTGCCTACTAGG - Intronic
970877987 4:20894686-20894708 ACATTAATTAAGCACCTATTTGG + Intronic
970893907 4:21079418-21079440 TCATTTATTGAACTCCTATTTGG + Intronic
970920991 4:21394911-21394933 CCATTTATTGAACATTGACTGGG + Intronic
970950563 4:21750600-21750622 CCATTTATTCAGCATTTACTAGG + Intronic
971169763 4:24221264-24221286 CAATTTATTGAACACTTACCAGG + Intergenic
971203057 4:24530845-24530867 ATATTTACTAAACACCTATTAGG + Intronic
971240401 4:24883415-24883437 CCATTCATTCAACAAATACTTGG + Intronic
971788475 4:31136219-31136241 CTATTTACTGAACACCTACACGG + Intronic
971949080 4:33320016-33320038 CCAATTATTAAACAATTATTAGG - Intergenic
972209398 4:36818994-36819016 CATTTTATTAAGCACCTGCTGGG + Intergenic
972452496 4:39216640-39216662 ACATTTATTAAGTACCCACTAGG - Intronic
972924709 4:43989494-43989516 GAATTTATTAAGCACCTACTAGG - Intergenic
973788433 4:54356825-54356847 ACATTTATTAAGCTCCAACTAGG + Intergenic
973912816 4:55599935-55599957 CTATTTATTGAACTTCTACTGGG - Intronic
974404356 4:61446783-61446805 GCATTTTTTAAACACCTACTAGG - Intronic
975360733 4:73468330-73468352 CCATTTGTTACCCACCTAGTTGG - Intergenic
975591705 4:76007151-76007173 ACATTTATTGAACACTTACTAGG + Intronic
975646223 4:76548601-76548623 ACATTTATTGAACAAATACTGGG - Intronic
975790828 4:77948567-77948589 GCATTTATTCAACACCCACTTGG - Intronic
976118317 4:81752065-81752087 GCATTTATTGAGCACCTGCTAGG - Intronic
976928284 4:90530101-90530123 ACATTCATTGAACACCTACTAGG + Intronic
977230672 4:94448753-94448775 CCATTTATTTAATCCTTACTTGG + Intergenic
977765594 4:100794058-100794080 ATATTTATTGAGCACCTACTTGG - Intronic
978092546 4:104736084-104736106 CAATTTAATAAACACTTATTTGG - Intergenic
978479774 4:109176047-109176069 ACATTTATCAGACACCTACCAGG + Intronic
979194830 4:117907965-117907987 ACATTTATTAAATATCTAATAGG - Intergenic
979262765 4:118667264-118667286 CCATTTATCAAATGCCTACATGG - Intergenic
980518310 4:133895006-133895028 ACATGTATTAATCACCTACAGGG + Intergenic
980902629 4:138919484-138919506 CCAGTTATTAAACACATTCGCGG + Intergenic
981100816 4:140827321-140827343 CCATTTACTGAGCACCTACTAGG + Intergenic
981742636 4:148018972-148018994 ACATTTAACAAACACCTACTAGG - Intronic
981791533 4:148542464-148542486 GCATTTGTTAAACACTTACTAGG + Intergenic
981926451 4:150145430-150145452 ACATTTACTCAACACCTATTAGG - Intronic
982065183 4:151648730-151648752 TCATTTCTTAAACATCTAGTAGG - Intronic
983105988 4:163686588-163686610 TAATTTTCTAAACACCTACTTGG + Intronic
984133957 4:175912860-175912882 ACATTTATTTATCACCTACAAGG - Intronic
984289823 4:177781414-177781436 CCATTTAACACACACCCACTGGG - Intronic
984682714 4:182628731-182628753 CTGTTTATTCACCACCTACTCGG + Exonic
984832856 4:183991750-183991772 CTATTTATTAAACATGTATTAGG + Intronic
985072011 4:186175557-186175579 ACATTTATTAAGCACTTTCTTGG + Intergenic
986372621 5:7094983-7095005 CCATTCATTACACACCTAATAGG + Intergenic
986468746 5:8052861-8052883 CCATTTCTTAAGCATCTGCTAGG + Intergenic
987063506 5:14265127-14265149 CCATTTAGTAAACACTAACTCGG + Intronic
987812230 5:22852716-22852738 CCATTTATAAAATAACTAGTTGG + Intronic
987987665 5:25170026-25170048 CCAATTAATAAACACACACTAGG - Intergenic
988249960 5:28744435-28744457 ACATTTATTAAACTTCTACATGG + Intergenic
988402967 5:30785701-30785723 GCATATATTGAACACCTACTAGG - Intergenic
988573787 5:32398973-32398995 ATATTTATTTAAAACCTACTAGG + Intronic
988607716 5:32694374-32694396 GCATTTATTGAACACTTACTTGG + Intronic
989540043 5:42607434-42607456 CAATTTCTTAAACATCAACTAGG + Intronic
989552466 5:42751889-42751911 CCTTGTATTCAACAACTACTTGG - Intergenic
990474344 5:56147090-56147112 TCATTTTTCATACACCTACTTGG + Intronic
990815970 5:59785402-59785424 ACGTTTATTGAGCACCTACTAGG + Intronic
990867042 5:60391173-60391195 ACATTTATTGCACATCTACTTGG - Intronic
991202260 5:64008261-64008283 CCACTTAAGAAACATCTACTGGG + Intergenic
992282743 5:75198764-75198786 ACATTTACTAAGCACCAACTAGG + Intronic
992492273 5:77256947-77256969 TAATTTATTAAATCCCTACTAGG + Intronic
993182967 5:84578679-84578701 CCATTTAACAAATAACTACTTGG + Intergenic
994115917 5:96061236-96061258 CCATTCAATAAACAGCTCCTGGG + Intergenic
995307718 5:110673527-110673549 TAATTTTTTAAACATCTACTAGG + Intronic
995421911 5:111977272-111977294 ACATGTATTAAACACTTGCTAGG + Intronic
995714363 5:115067756-115067778 CCATTTGTTAACCACCTCATTGG + Intergenic
995733168 5:115267675-115267697 ACATATATTAAATACCTTCTTGG + Exonic
996023359 5:118616079-118616101 CCACTTTTTAAACAACCACTTGG + Intergenic
996029000 5:118684293-118684315 GCACTTATTGAGCACCTACTGGG + Intergenic
996030216 5:118696397-118696419 GCATTTATTAAATGCCCACTAGG - Intergenic
996368884 5:122732479-122732501 CCATTTATTGAACATTTTCTAGG - Intergenic
997952272 5:138252073-138252095 CCATTTATTGAACACCTGCTTGG - Intergenic
998439151 5:142141818-142141840 CAATTTATTAAACACCTGCCAGG - Intronic
999438060 5:151579841-151579863 GCATTTATTTAGCAACTACTAGG - Intergenic
999458950 5:151741141-151741163 CCATTTATTGGGCACTTACTGGG - Intergenic
999931187 5:156434355-156434377 CCATTTATTAAACACACAGAGGG + Intronic
1000070112 5:157732539-157732561 ACATTTATTGAGCACTTACTAGG + Intronic
1000176289 5:158758216-158758238 TCATTTACTTAACATCTACTGGG + Intronic
1000640211 5:163693198-163693220 ATATTTATTAAGCACCTATTAGG - Intergenic
1000810922 5:165859925-165859947 ATATTTATTGAACACCTACAGGG + Intergenic
1000849786 5:166325733-166325755 ACATTTATTCAAAACCTCCTGGG + Intergenic
1001004921 5:168041753-168041775 ATATTTACTAAACACCCACTGGG - Intronic
1001517979 5:172369968-172369990 GTATTTATTAAGCACCTAGTAGG + Intronic
1001547192 5:172577824-172577846 GCATTTATTGATCACCTACCAGG + Intergenic
1001823375 5:174726615-174726637 CCATTTAATGATCACCTACCAGG + Intronic
1002080138 5:176732859-176732881 ACATTTATCAAGCACCTACCAGG + Intergenic
1002737471 5:181405899-181405921 CCATTTATCAAATGCCTACATGG - Intergenic
1002935745 6:1670830-1670852 GCATTTTTTAAAAACGTACTAGG - Intronic
1002968331 6:1989984-1990006 ACATTTCTTAAGCACCTACGTGG - Intronic
1003257219 6:4484993-4485015 CAATTTAACAAACACTTACTGGG + Intergenic
1004241862 6:13930732-13930754 CCATTTATTAAGCATTTACTTGG + Intronic
1004638672 6:17492908-17492930 ATATTTATTGAGCACCTACTAGG - Intronic
1004707248 6:18135963-18135985 ACATTTATTAAGCTCTTACTAGG + Intronic
1004821878 6:19376098-19376120 ACATCTATTTAACACCAACTTGG + Intergenic
1005305943 6:24514283-24514305 GCATTTAATGAGCACCTACTAGG - Intronic
1006434848 6:34020708-34020730 ACATTTATTGAGCATCTACTAGG + Intronic
1006663204 6:35667234-35667256 CTATTTATGGAACACTTACTAGG + Intronic
1007009530 6:38401873-38401895 ACATTTGTTGAACACTTACTAGG - Intronic
1007253653 6:40513542-40513564 CAATTTTTTGAACACCTACTAGG + Intronic
1007296136 6:40822517-40822539 CACTTTATTAAATACCAACTAGG - Intergenic
1007318597 6:41009902-41009924 CCATTTACTGAACAATTACTAGG - Intergenic
1007350648 6:41271220-41271242 ACATTTATTAAGCACTTATTAGG + Intronic
1007407502 6:41643486-41643508 ACATTTATTAAGCACCTACGAGG - Intronic
1007475524 6:42117196-42117218 ACATTTATTAGGCATCTACTAGG + Intronic
1008234559 6:49028354-49028376 ACATTTATTTAAAAGCTACTTGG + Intergenic
1008372097 6:50744557-50744579 CCATTTCTTAAAAATTTACTTGG + Intronic
1008543282 6:52564340-52564362 CCAATTTTTAAACACCTCCATGG + Intronic
1009493490 6:64322080-64322102 CTATTTACTAAGCACATACTCGG + Intronic
1010170787 6:72972729-72972751 CAATTTATTGAACACCTACTAGG - Intronic
1011118281 6:83920775-83920797 ATATTTATTGAACACCTACTAGG + Intronic
1011446042 6:87441473-87441495 CCATTGATTAAATACCCACAAGG + Intronic
1011491481 6:87898060-87898082 ACATTTATTGAAGGCCTACTGGG + Intergenic
1011748526 6:90432390-90432412 ACATTTATTAAACACCTACTAGG - Intergenic
1011822804 6:91272684-91272706 CCTTTTATTAAGCACCTAATAGG + Intergenic
1012294323 6:97501680-97501702 CCATTTATCAAACACCGACCAGG + Intergenic
1012454804 6:99392196-99392218 TCATTTATTCAGCACCTACCAGG + Intronic
1013651250 6:112197118-112197140 ACATTTATTAAGTACTTACTGGG - Intronic
1014259261 6:119197377-119197399 CAAGTAAGTAAACACCTACTAGG + Intronic
1014987610 6:128030934-128030956 ATATTTATTAGACACTTACTAGG + Intronic
1015953791 6:138579753-138579775 TAATTTTTTAAACATCTACTAGG - Intronic
1016029858 6:139326076-139326098 TCATTTATTGAGCACCTGCTTGG - Intergenic
1016724734 6:147349770-147349792 TCATTTATTAAATATCTACTGGG - Intronic
1017124779 6:151055290-151055312 ACATTTATTGAGCACTTACTAGG + Intronic
1017671765 6:156776776-156776798 GCATTTATTGAGTACCTACTGGG + Intergenic
1018192374 6:161321435-161321457 ACATTTATTAAACACCAAATTGG + Intergenic
1018875738 6:167821071-167821093 GCGTTTATTAAACATCCACTAGG + Intergenic
1019007479 6:168812348-168812370 CCATTTATTAAGGACCCAGTAGG + Intergenic
1020796623 7:12685380-12685402 ATATTTATTGAACACCTAATAGG - Intergenic
1021087265 7:16436454-16436476 ATATTTATTAAACATCTATTTGG - Intergenic
1021123404 7:16822557-16822579 ACATTTATTGAACACCTACTAGG - Intronic
1021283070 7:18744448-18744470 ACACTTATTAAACTCCTTCTAGG - Intronic
1021991003 7:26141636-26141658 CCACTTATTCAACACCTACTGGG - Intergenic
1022219009 7:28293638-28293660 ACATTTATTGAACCCCCACTGGG + Intergenic
1022261559 7:28710354-28710376 ATATTTATTAAGCACCTACTAGG + Intronic
1022277236 7:28867212-28867234 AGATTTCTTAAGCACCTACTAGG - Intergenic
1023035508 7:36128023-36128045 ACATTTATTGAACACCTACTGGG - Intergenic
1024093068 7:45963199-45963221 TCATTCATTAAACACTTACTAGG + Intergenic
1024928278 7:54641196-54641218 CCAATTTTTAAACACTTAATTGG + Intergenic
1025745308 7:64237603-64237625 CCAACTATTCAACACCAACTGGG + Intronic
1027883157 7:83868966-83868988 CCATTTATCAAACTCCTACTGGG + Intergenic
1028093106 7:86727625-86727647 TCATATATTAAACATCTGCTTGG - Intronic
1028229616 7:88291014-88291036 CATTTTCTTAAACACTTACTAGG - Intronic
1028419954 7:90621519-90621541 ACTTTTATTCAGCACCTACTAGG - Intronic
1028622583 7:92841295-92841317 GCATTTATTGACCACTTACTAGG - Intergenic
1029519824 7:101052892-101052914 CTCTTCATTAAACACCCACTGGG + Intronic
1029656446 7:101928276-101928298 CCATTTATTGACCTTCTACTTGG - Intronic
1029795643 7:102891536-102891558 CAATTCATTCAACAACTACTTGG - Intronic
1029989179 7:104947351-104947373 CCATTTATTAAATATTCACTAGG - Intergenic
1030311967 7:108078065-108078087 ACATATATTAAGCACTTACTGGG - Intronic
1030755390 7:113281875-113281897 ATATTTATTAAACATCTTCTAGG + Intergenic
1031871012 7:127090311-127090333 CCATTCATTTAACACATAATTGG - Intronic
1031881378 7:127202535-127202557 CCATCTATTGAATACCTACTGGG + Intronic
1032390072 7:131550106-131550128 ACATTTCTTAACCACCTATTTGG + Intronic
1033242964 7:139695926-139695948 ACATTTATTGGACACCTATTAGG - Intronic
1033262101 7:139852829-139852851 ACATTTTTTAAATGCCTACTCGG + Intronic
1033455871 7:141502840-141502862 TCATTTATTGAGCACTTACTGGG + Intergenic
1033461860 7:141553623-141553645 CCCTTTAATAAACACCTATATGG - Intronic
1033686020 7:143642269-143642291 CCATTTATGGAACACTTATTAGG + Intronic
1033689722 7:143725046-143725068 CCATTTATGGAACACTTATTAGG - Exonic
1033698593 7:143815352-143815374 CCATTTATGGAACACTTATTAGG - Intergenic
1034671155 7:152859499-152859521 GAATTTATTGAACACTTACTAGG - Intergenic
1035481417 7:159190333-159190355 CCATTTGTTCATCACCTCCTAGG - Intergenic
1035505552 8:126699-126721 CCATTTATCAAATGCCTACATGG + Intergenic
1036080551 8:5550704-5550726 CAATTTAATAAGCAGCTACTGGG + Intergenic
1037830071 8:22182515-22182537 GCATTTATGAAACACTTCCTGGG - Intronic
1038155617 8:24986826-24986848 CTATTTATTAAGCACCTCCCAGG + Intergenic
1038279113 8:26147631-26147653 GCATTTATTGAGCACCTACTAGG - Intergenic
1038420822 8:27433155-27433177 CTATTTATTGAGCACCTACTAGG + Intronic
1038941101 8:32306941-32306963 CCCATTATTAAAAACCTGCTAGG - Intronic
1039143998 8:34424547-34424569 CCATAGATTAAACACATAATAGG - Intergenic
1041567379 8:59294465-59294487 AAATTTATTGAACACATACTAGG + Intergenic
1041997495 8:64081421-64081443 CCATTTATTAAACAAACATTTGG + Intergenic
1042137591 8:65646378-65646400 CCATTTATTCCACAACTCCTAGG - Intronic
1042209841 8:66369168-66369190 TCATTTATTAAATACCTACAAGG + Intergenic
1042594986 8:70437409-70437431 CCAATTATTAAGCACCTGGTAGG - Intergenic
1042641223 8:70937289-70937311 CTATTTATTAGTCACATACTAGG + Intergenic
1043401029 8:79884493-79884515 ATATTTAATAAACATCTACTAGG - Intergenic
1043526303 8:81100274-81100296 TCATTTATTGAACACCTACTAGG - Intronic
1043624814 8:82243734-82243756 CCATTTATTAAAGTATTACTTGG - Intergenic
1044530925 8:93306798-93306820 TCATTTATCAAACATCTATTGGG - Intergenic
1044784424 8:95779409-95779431 ACATTTCTTGAGCACCTACTAGG + Intergenic
1044795036 8:95887911-95887933 CCTTTTATTGAGCACCTACTAGG - Intergenic
1045547959 8:103144852-103144874 TCATTTATTAATGACTTACTGGG + Intronic
1046525400 8:115376502-115376524 TTATTTATTACACACCTGCTCGG + Intergenic
1046759326 8:118004919-118004941 CCACTTTCTAAGCACCTACTTGG + Intronic
1047064146 8:121261851-121261873 TCATTTATTATATACCTTCTTGG + Intergenic
1047160960 8:122378790-122378812 TCATTTAATAAACAGTTACTGGG + Intergenic
1047319969 8:123769606-123769628 ATATTTATTGACCACCTACTAGG + Intronic
1047377147 8:124310639-124310661 CCTTTTATTAAACACTTATTTGG - Intergenic
1047509933 8:125508278-125508300 ACATTTACTGAGCACCTACTAGG + Intergenic
1047870491 8:129076919-129076941 CCATTTAGTTAACACTTAGTAGG - Intergenic
1048131759 8:131705478-131705500 ACATTTAATGAGCACCTACTAGG + Intergenic
1048242213 8:132753832-132753854 ACATTTATTAAGCCCATACTAGG - Intronic
1048372291 8:133789718-133789740 AAATGTATTTAACACCTACTTGG - Intergenic
1050067206 9:1772229-1772251 CTTTTTATCAAACACTTACTTGG + Intergenic
1050472941 9:6011052-6011074 CAATTTATTGAGCACTTACTAGG + Exonic
1050573064 9:6961971-6961993 TCATTTATAAATCAGCTACTGGG + Intronic
1050815339 9:9804585-9804607 AAATTTATTCAACACCTACTAGG - Intronic
1050993850 9:12188472-12188494 CTATTTATTGAGCACCTACAAGG + Intergenic
1051138547 9:13952085-13952107 CCATTTAATATAAACTTACTAGG - Intergenic
1051364469 9:16311289-16311311 ACGTTTATTGAACACATACTGGG - Intergenic
1051739434 9:20237271-20237293 CCATTTAGTGAGCACCTTCTAGG + Intergenic
1052182264 9:25544201-25544223 CTATTTATTAAACAATTTCTAGG - Intergenic
1052228612 9:26120015-26120037 ATATTCATTAAGCACCTACTAGG + Intergenic
1052277045 9:26688449-26688471 TCATTTATTAACCACCTACTAGG + Intergenic
1053350381 9:37410139-37410161 ATATTTATTGAGCACCTACTAGG + Intergenic
1053441633 9:38121055-38121077 CCATTAGTTAAGCACTTACTGGG + Intergenic
1053463206 9:38286665-38286687 CAATTTGTTGAACAGCTACTGGG - Intergenic
1055840841 9:80501111-80501133 ATATTTAATGAACACCTACTAGG - Intergenic
1056655994 9:88509617-88509639 CCATTTATTAAATGCCTGCCAGG + Intergenic
1056728326 9:89142149-89142171 CCATTTAGTAAAGTCCTTCTGGG - Intronic
1056993228 9:91430298-91430320 CCATTTATGGAGCACCTGCTGGG + Intergenic
1056993610 9:91433789-91433811 ACATTTATTAAACACTGCCTAGG - Intergenic
1058044914 9:100347689-100347711 TCATTTATTGAAAACCTACTAGG + Intronic
1058057123 9:100459955-100459977 GCATTTATTGAACACCTTCTGGG + Intronic
1058118235 9:101108383-101108405 ACATCTATTGAGCACCTACTGGG - Intronic
1058576562 9:106409880-106409902 CAATTTTTTAAAAACTTACTTGG + Intergenic
1058761078 9:108132980-108133002 CCAGCTATTAAACACTTATTAGG - Intergenic
1058914156 9:109549435-109549457 CCACTTATTAAGCCCCTACTGGG - Intergenic
1059469166 9:114491321-114491343 CCATTTCCTAAAAACCTACTCGG + Intronic
1059963734 9:119592920-119592942 ATATTTATAAAACACCTGCTAGG + Intergenic
1060073212 9:120569017-120569039 ACATGTATTACACACCTACTCGG + Intronic
1061805605 9:133136082-133136104 GAATTTACTGAACACCTACTAGG + Intronic
1186565694 X:10659917-10659939 CCATTTATTACAGACCTTCAAGG + Intronic
1186685456 X:11920594-11920616 ACATTTAATGAAAACCTACTGGG + Intergenic
1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG + Intergenic
1187012563 X:15294904-15294926 ACATTTATTGAGCATCTACTAGG + Intronic
1187678866 X:21745736-21745758 CCATTTATTAAGCATCTACAGGG + Intronic
1187974977 X:24695839-24695861 ATATTTATTATATACCTACTAGG + Intronic
1188185656 X:27111182-27111204 CTATTTATTAAACAACTGTTTGG + Intergenic
1188392484 X:29638396-29638418 ACATTTAGTAAACACCTTCTGGG + Intronic
1188423926 X:30024389-30024411 CCATTTATTTAACAAATGCTTGG + Intergenic
1189312475 X:40029447-40029469 CTACTTATTGAACACTTACTAGG - Intergenic
1189540501 X:41982842-41982864 ACATTTATTGAGCTCCTACTGGG + Intergenic
1189751355 X:44226062-44226084 CCATGTATTGAGCACTTACTGGG - Intronic
1190286297 X:48963487-48963509 GCATTTATTGAGCACCTACTGGG + Intronic
1190476474 X:50832932-50832954 CCATACATTTAACACCTATTTGG - Intergenic
1192544167 X:71998941-71998963 TCATTTATTAAGCACCTATTAGG - Intergenic
1193806023 X:85995729-85995751 CCATTTACTGAACAGTTACTTGG - Intronic
1194668481 X:96702109-96702131 ACATTTATTAGACTCCTAATAGG - Intronic
1194680166 X:96842563-96842585 CCATGTATAAAATACCTACTAGG + Intronic
1194803383 X:98298612-98298634 ATATTTATTGAGCACCTACTGGG + Intergenic
1195260216 X:103124513-103124535 CCATTTGTTGAAATCCTACTAGG + Intergenic
1195994076 X:110713824-110713846 CCATTTACTAAATGCATACTTGG + Intronic
1196134068 X:112188025-112188047 CCATTTATTGAGCATCTACTAGG + Intergenic
1196207801 X:112960911-112960933 ATATTTATTAGACACCTGCTAGG + Intergenic
1196222887 X:113132569-113132591 CTAATTATTAATCACCTACTTGG + Intergenic
1196745807 X:119070861-119070883 ACATTTATCAAACACCGACCTGG + Intergenic
1197264114 X:124347732-124347754 ACATTTATTGAACATTTACTAGG - Intronic
1197390426 X:125856553-125856575 ACATTTATGAAATATCTACTGGG + Intergenic
1197775133 X:130113956-130113978 ACATTTATTGAAGACTTACTGGG - Intergenic
1197886812 X:131226984-131227006 ACATTTACTAAGCTCCTACTGGG - Intergenic
1197996607 X:132382921-132382943 CCATTTATCAAACAAATACATGG + Intronic
1198018822 X:132638363-132638385 GCATTTATTAAACTCCTGTTTGG - Intronic
1198174546 X:134142543-134142565 CCAATTATTGAGCACCTATTAGG + Intergenic
1198676617 X:139138087-139138109 CCATTTATGAAGCACTTACTGGG + Intronic
1198696115 X:139340392-139340414 ATATTTATTGAGCACCTACTGGG + Intergenic
1198764853 X:140070095-140070117 TCATTTACTTAACAACTACTTGG - Intergenic
1199315046 X:146366984-146367006 ACATTTATTGAGCACCTGCTCGG + Intergenic
1199462410 X:148099172-148099194 ACATTTGTTAAACTCCTACTTGG - Intergenic
1199513611 X:148650944-148650966 ACATTTATCCAACACCTGCTAGG + Intronic
1199590561 X:149464377-149464399 ATATTTATTGAGCACCTACTAGG + Intergenic
1199800196 X:151243002-151243024 CCAACAATTAAGCACCTACTTGG - Intergenic
1200311085 X:155078016-155078038 CTATTTGTTAAGCACTTACTAGG + Intronic
1201505404 Y:14693933-14693955 GCATGTATTAAACACCTTGTTGG + Intronic
1202384829 Y:24315723-24315745 CCATTTATCAAATGCCTACATGG - Intergenic
1202485955 Y:25354399-25354421 CCATTTATCAAATGCCTACATGG + Intergenic