ID: 1121740796

View in Genome Browser
Species Human (GRCh38)
Location 14:96251056-96251078
Sequence CTGAGAAAACCATCGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121740796 Original CRISPR CTGAGAAAACCATCGCAGGT GGG (reversed) Intronic
900591219 1:3460872-3460894 CTGCTAAAACCATCCCAGGAAGG - Intronic
917932661 1:179834041-179834063 CACAGAAAACCATGGCAGTTAGG + Intergenic
1064848871 10:19687471-19687493 CAGAGAAAACCAGTGCAAGTGGG - Intronic
1068869030 10:61924012-61924034 CTGACAAAACAATCACAGGAGGG - Intronic
1073606304 10:104899357-104899379 GTTAGAATAACATCGCAGGTAGG + Intronic
1074551755 10:114449639-114449661 ATGAGAAAACCATTTCAGCTTGG + Intronic
1075358429 10:121806152-121806174 TTTAAAAAACCATAGCAGGTTGG + Intronic
1078836204 11:15032627-15032649 CTGAGAAAAACATGGCACATGGG + Intronic
1082273127 11:50193579-50193601 CTAAGAAAATCATCACGGGTGGG + Intergenic
1084664888 11:70571035-70571057 CTCAGAAAACCACAGCAGCTGGG + Intronic
1085474132 11:76778929-76778951 CTGAGAAAAGCATTCCAGGCAGG + Intergenic
1089304249 11:117516812-117516834 CTGAGAAGAGCACCGCAGGGTGG - Intronic
1093542195 12:20300444-20300466 CTGATAAAACCTTGGCAGGTTGG + Intergenic
1098382332 12:69882072-69882094 AGCAGAAAACCATCGCAGGATGG - Intronic
1102001249 12:109559292-109559314 ATGACAAATCCATCACAGGTGGG + Intronic
1102938397 12:116916600-116916622 ATGAGAAAACCATCCAAGCTGGG + Intronic
1104075228 12:125383054-125383076 CTGAGAAACCCACTCCAGGTTGG - Intronic
1109681448 13:65757646-65757668 GTGAGAAAGCCATCTCAGTTGGG + Intergenic
1110944015 13:81390265-81390287 CTGAGAAAACCACAGCAGCAAGG + Intergenic
1112537580 13:100275110-100275132 GTGAGAAAACCACTGCAGGAAGG - Intronic
1113091814 13:106624788-106624810 GTGAGAAACCCATGGAAGGTTGG + Intergenic
1114252540 14:20973400-20973422 CTTAGAAAACCTTCTCAGGCTGG - Intergenic
1117090270 14:52243458-52243480 CTTAGAAAACCATCACATTTTGG + Intergenic
1121740796 14:96251056-96251078 CTGAGAAAACCATCGCAGGTGGG - Intronic
1121808503 14:96856569-96856591 CTGAGAAAAACAAACCAGGTAGG + Exonic
1124449177 15:29769926-29769948 CTGAGAAAACAGCCTCAGGTAGG + Intronic
1129686964 15:77691845-77691867 CTGAGAAAATGAGTGCAGGTGGG + Intronic
1131649980 15:94387893-94387915 CTGAGAAATCCCTCCCAGGCAGG + Intronic
1133621729 16:7532694-7532716 TTGACAAAAACATCGCAGGCAGG - Intronic
1138133307 16:54500361-54500383 ATGTGAAAACCATCTGAGGTTGG - Intergenic
1138890068 16:61130902-61130924 CTGATAAAACCCTAGCAGGTTGG + Intergenic
1140701531 16:77586074-77586096 CTGAGAAACCGATGCCAGGTGGG - Intergenic
1141697256 16:85625962-85625984 CTGAGAAAACACAAGCAGGTGGG - Intronic
1143530790 17:7502176-7502198 CTGAGAAACCCCTAACAGGTGGG + Intronic
1147530346 17:41270634-41270656 CAGAGAGAACCAAAGCAGGTGGG - Intergenic
1150120218 17:62594898-62594920 CTGAGAAAACCCACACAGATAGG + Intronic
1151360159 17:73583978-73584000 CTAAGGAAACCATTCCAGGTGGG - Intronic
1155421445 18:25660695-25660717 CTATGAAAAACATCACAGGTTGG - Intergenic
1161168353 19:2800634-2800656 CTGAGGGAACACTCGCAGGTCGG + Intronic
1162874332 19:13609685-13609707 CTTAGAAAAACATCCCAGGCTGG - Intronic
1164483792 19:28637481-28637503 CTGAGAAAATCAGAGAAGGTGGG - Intergenic
1165472249 19:36010359-36010381 CTGTGAAAATCATGGCATGTGGG + Intronic
926453128 2:13030901-13030923 CTGAGACCAACATGGCAGGTGGG + Intergenic
930012563 2:46948530-46948552 CCAAGAACACCATCGCAGGGGGG - Intronic
931090085 2:58876347-58876369 CTGAGAAAACCATGGGGGTTTGG - Intergenic
932818673 2:74881502-74881524 CTGAGAAAACCCTCCCTTGTTGG - Intronic
932836586 2:75043711-75043733 CTGTGAAAGCCATCTCAGTTTGG + Intergenic
936684790 2:114815106-114815128 CTGCCAACACCATCCCAGGTGGG - Intronic
938123001 2:128646713-128646735 CTGAGAAAACCAAGGCAGAGAGG + Intergenic
939252648 2:139702371-139702393 CTTTGAAATCCATGGCAGGTTGG - Intergenic
942802467 2:179891540-179891562 CTGAGAGAACCAACACAGTTAGG + Intergenic
946869806 2:224075257-224075279 CTCAGAACCCCATGGCAGGTTGG - Intergenic
947277910 2:228415668-228415690 CTGAGAAAAGCATTGGAAGTGGG + Intergenic
947722523 2:232378567-232378589 CTGAGAAAGGCAGCTCAGGTTGG - Exonic
1173620183 20:44430406-44430428 CCGAGAAAACAAACCCAGGTTGG + Exonic
1178870592 21:36371353-36371375 CTGAAAAACCCATCATAGGTTGG + Intronic
1181180606 22:21065569-21065591 GTGACAAAACCATCGGTGGTGGG + Intergenic
1184768278 22:46583779-46583801 CTGACAAACACATCTCAGGTGGG - Intronic
1184845092 22:47077962-47077984 CTGAGACAACCATTCCAGGAAGG - Intronic
949845570 3:8367157-8367179 CTATTAAAACCATCTCAGGTTGG + Intergenic
957006948 3:74960084-74960106 CTGAGAAAATAATCTCAAGTTGG + Intergenic
957115512 3:76019433-76019455 CAGAGAAAACCAAAGCATGTGGG - Intronic
958466024 3:94459798-94459820 CTGAGAAAACTTAAGCAGGTAGG - Intergenic
959139944 3:102473467-102473489 CTGAGAAAACTCTAGCATGTTGG - Intronic
960429132 3:117547367-117547389 CTGAGAAAAGCTTGGCAGGAGGG - Intergenic
961994992 3:131233069-131233091 CTGATAAAACCTTGGCAGGCAGG + Intronic
963011461 3:140774405-140774427 CAGTGAAAACCATCCAAGGTAGG + Intergenic
967676823 3:192309304-192309326 CTTAGGAAACCATAGCAGATGGG - Intronic
969025056 4:4166346-4166368 CTGGGAAAAATATCACAGGTGGG - Intergenic
969236797 4:5871043-5871065 CTAGGAAAAGCATAGCAGGTTGG - Intronic
969662378 4:8537838-8537860 CTGAGAGAACCTCGGCAGGTGGG + Intergenic
969789340 4:9481243-9481265 CTGGGAACAACATCACAGGTGGG + Intergenic
971716773 4:30188043-30188065 CTTAAACAACCATCTCAGGTAGG - Intergenic
974332832 4:60502325-60502347 TTGTGAAAGCCTTCGCAGGTAGG + Intergenic
978872265 4:113593703-113593725 CTGATAAAACCCCAGCAGGTTGG - Intronic
981471824 4:145144364-145144386 CAGAGAAAATCATCACATGTAGG - Exonic
988516922 5:31913003-31913025 TTGAGAAAAGCATCACATGTAGG + Intronic
993352403 5:86866524-86866546 GTGAGACAACCATAGCAGGCTGG + Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
993756918 5:91743094-91743116 CTTAGAAAACCATAGCAAGTAGG - Intergenic
996603826 5:125297363-125297385 CTGAGAACACCGTGCCAGGTTGG - Intergenic
1004693059 6:18009342-18009364 GTGGGAAAACCATCTCAGGTTGG + Intergenic
1007474980 6:42113517-42113539 CTTAGAAAACCAAGGCAGCTGGG + Intronic
1016901418 6:149106751-149106773 CTCAGAAATCCATCTTAGGTGGG + Intergenic
1018368996 6:163150025-163150047 GTGAGAAAACCATCGAAAGAAGG - Intronic
1018924125 6:168194767-168194789 CTGAGGATGCCATGGCAGGTGGG - Intergenic
1019141103 6:169943812-169943834 CTGATAAAACCCCTGCAGGTGGG - Intergenic
1019329184 7:454317-454339 CTGAGTAAACAAGCCCAGGTTGG + Intergenic
1026481909 7:70786694-70786716 CTGAGCATACCGTCACAGGTCGG + Intronic
1029127066 7:98301829-98301851 CTGAGAATACCAGCTCAGGTGGG + Intronic
1035276438 7:157750816-157750838 CTGAGGAAGCCATCTCAGGCGGG - Intronic
1037088648 8:14885094-14885116 CTGAAAATCCCATCCCAGGTGGG + Intronic
1041141355 8:54823154-54823176 CTGAGAAAGCCCTCCCCGGTGGG + Intergenic
1041896398 8:62929345-62929367 GTGAGAAAAAAATCACAGGTTGG + Intronic
1041971360 8:63746749-63746771 CTGGGACAACCAACGCATGTTGG - Intergenic
1044340782 8:91044299-91044321 CTGAGAAAGCCATTGATGGTGGG - Intergenic
1044439797 8:92209744-92209766 CTGAGAAACCCAACGGGGGTTGG - Intergenic
1044685414 8:94821742-94821764 CTGAGAATACCAGCTCAGGGAGG - Intronic
1049141968 8:140963049-140963071 CTGAGGAAACTATAGCACGTGGG - Intronic
1053534389 9:38911729-38911751 CCGAGACCACCATAGCAGGTAGG + Intergenic
1054206612 9:62136148-62136170 CCGAGACCACCATAGCAGGTAGG + Intergenic
1054631744 9:67452198-67452220 CCGAGACCACCATAGCAGGTAGG - Intergenic
1057051169 9:91925212-91925234 CTGAGAGAACCATCGCTGTAGGG + Intronic
1060587662 9:124796463-124796485 CTGTGGAAACCATCTCTGGTTGG - Intronic
1061069324 9:128299215-128299237 AGGAGACAAGCATCGCAGGTAGG - Intergenic
1189121330 X:38398377-38398399 TCGAGAAAACCATAACAGGTTGG + Intronic
1197522786 X:127520304-127520326 CTGGGAGACCCATTGCAGGTTGG - Intergenic
1198001168 X:132438383-132438405 CTGAGGAAACCATCACACGAAGG + Intronic
1199478589 X:148273465-148273487 CTTAGAACTCCATCCCAGGTAGG - Intergenic