ID: 1121741094

View in Genome Browser
Species Human (GRCh38)
Location 14:96252876-96252898
Sequence GTGCTGGCTCTGGGGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 602}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121741094_1121741102 -3 Left 1121741094 14:96252876-96252898 CCTTCCCACCCCAGAGCCAGCAC 0: 1
1: 0
2: 4
3: 72
4: 602
Right 1121741102 14:96252896-96252918 CACCCAGGACCCTTCACTTCTGG 0: 1
1: 0
2: 0
3: 25
4: 201
1121741094_1121741109 10 Left 1121741094 14:96252876-96252898 CCTTCCCACCCCAGAGCCAGCAC 0: 1
1: 0
2: 4
3: 72
4: 602
Right 1121741109 14:96252909-96252931 TCACTTCTGGGCTGGCTGCCAGG 0: 1
1: 0
2: 1
3: 38
4: 244
1121741094_1121741110 16 Left 1121741094 14:96252876-96252898 CCTTCCCACCCCAGAGCCAGCAC 0: 1
1: 0
2: 4
3: 72
4: 602
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741094_1121741103 -2 Left 1121741094 14:96252876-96252898 CCTTCCCACCCCAGAGCCAGCAC 0: 1
1: 0
2: 4
3: 72
4: 602
Right 1121741103 14:96252897-96252919 ACCCAGGACCCTTCACTTCTGGG 0: 1
1: 0
2: 4
3: 13
4: 190
1121741094_1121741111 26 Left 1121741094 14:96252876-96252898 CCTTCCCACCCCAGAGCCAGCAC 0: 1
1: 0
2: 4
3: 72
4: 602
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741094_1121741106 2 Left 1121741094 14:96252876-96252898 CCTTCCCACCCCAGAGCCAGCAC 0: 1
1: 0
2: 4
3: 72
4: 602
Right 1121741106 14:96252901-96252923 AGGACCCTTCACTTCTGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121741094 Original CRISPR GTGCTGGCTCTGGGGTGGGA AGG (reversed) Intronic