ID: 1121741095

View in Genome Browser
Species Human (GRCh38)
Location 14:96252880-96252902
Sequence CTGGGTGCTGGCTCTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 590}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121741095_1121741102 -7 Left 1121741095 14:96252880-96252902 CCCACCCCAGAGCCAGCACCCAG 0: 1
1: 0
2: 5
3: 74
4: 590
Right 1121741102 14:96252896-96252918 CACCCAGGACCCTTCACTTCTGG 0: 1
1: 0
2: 0
3: 25
4: 201
1121741095_1121741103 -6 Left 1121741095 14:96252880-96252902 CCCACCCCAGAGCCAGCACCCAG 0: 1
1: 0
2: 5
3: 74
4: 590
Right 1121741103 14:96252897-96252919 ACCCAGGACCCTTCACTTCTGGG 0: 1
1: 0
2: 4
3: 13
4: 190
1121741095_1121741106 -2 Left 1121741095 14:96252880-96252902 CCCACCCCAGAGCCAGCACCCAG 0: 1
1: 0
2: 5
3: 74
4: 590
Right 1121741106 14:96252901-96252923 AGGACCCTTCACTTCTGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 131
1121741095_1121741109 6 Left 1121741095 14:96252880-96252902 CCCACCCCAGAGCCAGCACCCAG 0: 1
1: 0
2: 5
3: 74
4: 590
Right 1121741109 14:96252909-96252931 TCACTTCTGGGCTGGCTGCCAGG 0: 1
1: 0
2: 1
3: 38
4: 244
1121741095_1121741111 22 Left 1121741095 14:96252880-96252902 CCCACCCCAGAGCCAGCACCCAG 0: 1
1: 0
2: 5
3: 74
4: 590
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741095_1121741110 12 Left 1121741095 14:96252880-96252902 CCCACCCCAGAGCCAGCACCCAG 0: 1
1: 0
2: 5
3: 74
4: 590
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121741095 Original CRISPR CTGGGTGCTGGCTCTGGGGT GGG (reversed) Intronic